Skip to main content
Download PDF

Identification and Validation of Genus/Species-Specific Short InDels in Dairy Ruminants

BMC Veterinary Research volume 21, Article number: 215 (2025) Cite this article

Abstract

Background

Over the past thirty years, the identification of species-specific molecular markers has significantly advanced our understanding of genetic diversity in both plants and animals. Among these, short InDels have emerged as vital genomic features, contributing more to sequence divergence than single nucleotide polymorphisms do in closely related species. This study aimed to identify specific InDels for Bos taurus, Bubalus bubalis, Capra hircus, and Ovis aries via an in silico approach and validated them in 400 individuals (100 for each species).

Results

We identified and characterized short, specific InDels in the sequences of the CSN1S1, CSN1S2, MSTN, and PRLR genes, which can be used for species identification of Capra hircus, Ovis aries, Bos taurus, and Bubalus bubalis, respectively. We developed a Tetraplex Specific PCR assay to enable efficient discrimination among these species.

Conclusions

This study highlights the utility of InDels as biallelic, codominant markers that are cost-effective and easy to analyse, providing valuable tools for genetic diversity analysis and species identification.

Peer Review reports

Introduction

In the past three decades, a wide range of molecular markers have been successfully developed for both plants and animals. Among these, the most common include Short Tandem Repeat Polymorphisms (STRP), Variable Number Tandem Repeats (VNTR), Restriction Fragment Length Polymorphism (RFLPs) or Amplified Fragment Length Polymorphisms (AFLPs), Randomly Amplified Polymorphic DNAs (RAPDs) or Inter-simple sequence repeats (ISSRs) and Inter-retrotransposon Amplified Polymorphisms (IRAPs), Allele Specific Associated Primers (ASAPs), Single Nucleotide Polymorphisms (SNPs), and polymorphic INsertions and DELetions (InDels). The last ones are gain or loss of nucleotides in a single locus and are the most frequent polymorphisms in mammalian genomes after SNPs [1]. They are classified as short InDels when fewer than 50 nucleotides are involved and long InDels when more than 50 nucleotides are involved [2]. In humans, it is estimated that there is one short InDel every eight nucleotides [1]. However, InDels contribute more to sequence divergence than do SNPs in terms of base differences [2]. With respect to selective pressures on InDels, deletions consistently segregate at lower frequencies than insertions do, both within genes and across the genome. This has been interpreted as evidence of a stronger purifying selection acting on deletions. A possible mechanistic explanation is that deletions have two breakpoints, rather than just one for insertions, making them more likely to disrupt important motifs [2].

Short InDels have been implicated in various genomic evolutionary processes, such as the evolution of genome size, and may play a key role in maintaining optimal intron size [2]. Furthermore, short InDels are more strongly affected by purifying selection and less affected by positive selection than are SNPs. No significant differences have been observed in the impact of balancing or divergent selection between short InDels and SNPs, as both are similarly distributed across the genome and likely respond to indirect selection in the same way. However, a few genomic regions affected by divergent selection were detected by InDels but not by SNPs [3]. In recent years, interest in identifying, mapping, and functionally analysing InDels has increased, as they are useful for studying evolutionary processes, detecting genomic signatures of selection, serving as genetic markers for quantitative trait loci (QTL) mapping, for association studies with economically important traits (Marker-Assisted Selection, MAS), and for disease studies [4, 5]. In most cases, these markers are dimorphic intraspecies InDels (Non-Species-Specific indels, NSS) and are mainly used in association studies with traits of interest [6,7,8,9,10,11,12,13,14]. In contrast, species-specific InDels in ruminants (Target Species-Specific InDels, TSS), have rarely been identified [15], likely due to difficulties in sequence allignment.

This study aimed to (a) identify specific InDels for domestic cattle (Bos taurus), river buffalo (Bubalus bubalis), goats (Capra hircus), and sheep (Ovis aries) using an in silico approach and develop polymerase chain reaction (PCR)-based InDel markers; (b) validate the species specificity of the identified InDel markers; and (c) set up a Tetraplex Specific PCR (TetraS-PCR) assay for the discrimination of these four species in biological samples.

Materials and methods

Samples

DNA from 400 individuals representing four species from four different genera: Bubalus, Bos, Ovis, and Capra has been analysed. The samples were distributed as follows: 100 samples from Bubalus bubalis (Mediterranean Italian River Buffalo breed), 100 from Bos taurus (30 Agerolese 20 Piemontese, 25 Podolica, and 25 Bruna cattle), 100 from Capra hircus (25 Napoletana, 20 Sarda, 20 Garganica, 20 Alpine, and 15 Maltese goats), and 100 from Ovis aries (30 Laticauda, 30 Sarda, and 40 Bagnolese sheep). All the animals were reared in Italy.

The DNA concentration and optical density (260/280 ratio) of each sample were estimated via a Nanodrop ND-2000C Spectrophotometer (Thermo Scientific, Waltham, MA, USA). The A260/A280 ratios for all the DNA samples ranged between 1.8 and 1.96.

Bioinformatics, sequence analysis and multiple sequence alignment

To identify specific InDels the genomic sequences of all Artiodactyla and Perissodactyla species available in GenBank were aligned for genes associated with milk and meat traits which are highly conserved across species due to their fundamental role. Homology searches, comparisons of nucleotide sequences among genes, and multiple alignments for InDels discovery were accomplished via NCBI-BLASTN version 2.2.5 [16]. Finally, an extensive literature review was conducted.

Allele-specific (AS) primer design and single AS‒PCR amplification conditions for InDels identification

αS1-casein (CSN1S1), αS2-casein (CSN1S2), Myostatin (MSTN) and Prolactin receptor (PRLR) were selected as target genes for Capra hircus, Ovis aries, Bos taurus, and Bubalus bubalis, respectively.

An AS‒PCR mixture with a final volume of 25 μL was prepared for each gene (MSTN, CSN1S1, and CSN1S2) by mixing 100 ng of genomic DNA, 1 × Green GoTaq1 Flexi Buffer, 1.5 mM MgCl2, 200 μM each dNTP, 10 pmol of each primer, and 1 U of GoTaq® G2 Flexi DNA Polymerase (Promega–Madison, Fitchburg, WI, USA). The thermal protocol included a first cycle of denaturation at 97 °C for 2 min, annealing at 58 °C (59 °C for the Ovis aries CSN1S1-specific amplification) for 45 s and extension at 72 °C for 1 min. This was followed by 35 cycles of denaturation at 97 °C for 45 s, annealing at 58 °C (59 °C) for 45 s, and extension at 72 °C for 1 min. A final cycle was performed at 97 °C for 45 s and 58 °C (59 °C) for 45 and 72 °C for 5 min to complete the reaction.

InDel detection at the PRLR locus was carried out according to Cosenza et al. [15]. For the other genes, target InDel regions were selected on the basis of the inclusion or exclusion of species-specific short InDels in the reverse primer sequences (Additional file 1).

The primers used were designed via DNASIS-Pro software (Hitachi, Tokyo, Japan) and purchased from Eurofins (Eurofins Genomics, Germany).

Ten percent of the PCR products for each species were Sanger sequenced, for a total of 160 sequences, at CEINGE-Biotecnologie Avanzate (Naples, Italy).

TetraS-PCR assay

The primers used for TetraS-PCR were the same as those used for AS-PCR, with the exception of those for PRLR amplification in Bubalus bubalis and the forward primer used for CSN1S2 amplification in Ovis aries, which were redesigned (Additional file 2).

To set up the TetraS-PCR, three DNA sample combinations were prepared: a) Bos taurus and Bubalus bubalis, b) Capra hircus and Ovis aries, and c) a mixture of Bos taurus, Bubalus bubalis, Capra hircus and Ovis aries, with equal quantities of reference DNA from each species included in each sample. TetraS-PCR was carried out by adding all four primer pairs (10 pM of each primer) and 100 ng of DNA to the reaction mix (see the previous section).

The thermal profile was the same as that used for AS‒PCR. All the PCR products were analysed directly by electrophoresis on a 3.0% Tris–borate-ethylenediaminetetraacetic acid (TBE) agarose gel (Bio-Rad, Hercules, CA, USA) in 0.5 × TBE buffer and stained with SYBR green nucleic acid stain (Lonza Rockland, Inc., Rockland, ME, USA).

Results

In silico species-specific InDels identification

The comparison of available gene sequences in NCBI database for Artiodactyla and Perissodactyla species led to the identification of specific InDels at the CSN1S1, CSN1S2, MSTN and PRLR loci for Capra hircus, Ovis aries, Bos taurus, and Bubalus bubalis, respectively.

A comparative analysis of the CSN1S1 gene sequences available in the databases for different mammals revealed a specific 28 bp insertion (KC951931.1:g.1989–2016insTGTACAATGCCATTAATATATTGTACAA) in the proximal promoter region of this gene in the genus Capra. This insertion is localized between two elements of retroposonic origin (full-length Bov-tA elements) [17]. Interestingly, the first 20 nucleotides, which are almost perfectly duplicated, are absent in all species from the Artiodactyl and Perissodactyl orders (X59856.2:g.9508-9509delTGTACAATGCCATTAATATA). The only exceptions are species that are members of the genus Ovis (such as Ovis aries and Ovis ammon), which instead show a deletion of the second of three repetitions, TGTACAA, found in goats (JN701803.1:g.91–92delTGTACAA) (Additional files 3 and 4).

Similarly, the comparison of all sequences of the CSN1S2 gene, encoding αs2-casein for major ruminant species available in public databases, revealed a 14 bp deletion in intron 1, which is unique to the genus Ovis (KT283354.1:g.643-644delAGAAATCAAATCTT) (Additional file 5). Notably, the absence of this sequence might represent the ancestral condition of the gene, as it is almost conserved in all species belonging to the Artiodactyla and Perissodactyla orders (Additional file 6). The only exceptions are the species from the Tilopoda suborder, which have a deletion in the same region of intron 1 of the CSN1S2 gene (GenBank nos. OQ730238 and OQ730239) [18].

In the case of the MSTN gene, both literature and in silico (GenBank) evaluations have shown that Bos taurus is characterized by the deletion of a 16 bp DNA fragment in intron 1 (AB076403.1:g.1207-1208delGAGTAGGTTATGGCTT). In contrast, all species belonging to the Artiodactyla and Perissodactyla orders, including other species within the Bos genus (such as Bos grunniens, Bos mutus, Bos frontalis, Bos javanicus, Bos gaurus, and Bos indicus), carry the insertion (Additional files 7 and 8).

Finally, a comparison of PRLR gene sequences available in the database for the main ruminant species revealed a deletion of the heptamer CACTACC located between nucleotides 1102 and 1103 of exon 10 (3’-UTR) in all species of the genus Bubalus. In contrast, this heptamer is highly conserved across all species belonging to the Artiodactyla and Perissodactyla orders [15] (Additional files 9 and 10). Through genotyping via an AS‒PCR-based method, the authors confirmed the specificity of this genetic marker for bubaline species.

InDels detection via AS‒PCR

To verify the species specificity of the genetic markers at the CSN1S1, CSN1S2, and MSTN loci, three novel allele-specific PCR methods were developed. Moreover, the method proposed by [15] was adopted for PRLR.

To validate and confirm the specific amplification of DNA and the homozygous conditions for each species-specific marker, ten per cent of the PCR products for each species was Sanger sequenced, for a total of 160 sequences, at CEINGE-Biotecnologie Avanzate (Naples, Italy).

Identification by AS‒PCR of carriers of short InDels at the CSN1S1 5’UTR

To identify carriers of the 28 bp insertion (KC951931.1:g.1989–2016insTGTACAATGCCATTAATATATATTGTACAA), the 20 bp deletion (X59856.2:g.9508–9509delTGTACAATGCCATTAATATA), and the 7 bp deletion (JN701803.1:g.91–92delTGTACAA) in the proximal promoter region of the CSN1S1 gene, AS‒PCR protocols were developed. Using these methods, samples homozygous for the specific InDels in the CSN1S1 gene were successfully amplified via PCR with only the reverse primers for the 28 bp “insertion”, the 20 bp “deletion”, or the 7 bp “deletion”.

In particular, the AS-PCR reaction mix with the reverse primer specific for the 28 bp insertion (CSN1S1ins28) (Additional file 1) amplified only samples with DNA from Capra hircus (183 bp). Conversely, the AS‒PCR mix with the reverse primer for the 20 bp deletion (CSN1S1del20) amplified only DNA from Bos taurus and Bubalus bubalis (162 bp), whereas the mix with the reverse primer for the 7 bp deletion (CSN1S1del7) amplified only DNA from Ovis aries (183 bp) (Fig. 1).

Fig. 1
figure 1

Identification by AS-PCR of carriers of InDels at the CSN1S1 5’UTR: (A) 28 bp insertion (TGTACAATGCCATTAATATATTGTACAA) (primer reverse: CSN1S1ins28); B 20 bp deletion (TGTACAATGCCATTAATATA) (primer reverse: CSN1S1del20), and (C) 7 bp deletion (TGTACAA) (primer reverse: CSN1S1del7) in Capra hircus (1), Ovis aries (2), Bos taurus (3), and Bubalus bubalis (4). M = Marker 1 kb Opti-DNA Ladder (0.1–10 kb) (Biolabs)

Full size image

Identification by AS‒PCR of carriers of the short InDel at CSN1S2 intron 1

Two allele-specific reverse primers, differing in the presence or absence of the 14 bp sequence (AGAAATCAAATCTT), were designed to verify the species specificity of the genetic marker at intron 1 of the CSN1S2 locus.

When the primer pair (F/R) CSN1S2/CSN1S2ins14 was used, only samples homozygous for 14 bp insertion in the CSN1S2 gene were successfully amplified via PCR (86 bp). In contrast, when the primer pair (F/R) CSN1S2/CSN1S2del14 was used, only samples homozygous for the ‘non-insertion’ allele (76 bp) were successfully amplified.

Genotyping of the four species from different randomly chosen breeds and genetic types confirmed that only Ovis aries samples were characterized by the absence of the 14 bp sequence (Fig. 2).

Fig. 2
figure 2

Identification by AS-PCR of carriers of the 14 bp InDel (AGAAATCAAATCTT) at CSN1S2 intron 1: (A) 14 bp deletion (primer reverse: CSN1S2del14); B 14 bp insertion (primer reverse: CSN1S2ins14) in Capra hircus (1), Ovis aries (2), Bos taurus (3), and Bubalus bubalis (4). M = Marker 1 kb Opti-DNA Ladder (0.1–10 kb) (Biolabs)

Full size image

Identification by AS‒PCR of carriers of short InDel at MSTN intron 1

The species specificity of 16 bp short InDels at intron 1 of the MSTN gene was validated via allele-specific primers designed on the basis of the presence or absence of the mutational event.

Specifically, the AS-PCR mixture with the reverse primer MSTNdel16 was successfully amplified exclusively for Bos taurus DNA samples (211 bp). Conversely, when the primer specific for the presence of the insertion (MSTNins16) was used, amplification was achieved only for DNA samples from Bubalus bubalis (203 bp), Capra hircus (209 bp), and Ovis aries (209 bp) (Fig. 3).

Fig. 3
figure 3

Identification by AS-PCR of carriers of the 16 bp InDel (GAGTAGGTTATGGCTT) at MSTN intron 1: (A) 16 bp deletion (primer reverse: MSTNdel16); B 16 bp insertion (primer reverse: MSTNinsl16) in Capra hircus (1), Ovis aries (2), Bos taurus (3), and Bubalus bubalis (4). M = Marker 1 kb Opti-DNA Ladder (0.1–10 kb) (Biolabs)

Full size image

Identification by AS‒PCR of InDel carriers at PRLR exon 10

To confirm the species specificity of the CACTACC heptamer deletion at exon 10 of the PRLR gene for bubaline species, the method proposed by [15] was used.

Genotyping of the 400 DNA samples validated the specificity of this InDel for the bubaline species, thus confirming the findings from the in silico analyses and the literature [15].

TetraS-PCR assay

To set up the TetraS-PCR assay, new primer pairs (forward and reverse) were designed for the specific amplification of the PRLR gene in Bubalus bubalis. Additionally, a new forward primer was designed for the specific amplification of Ovis aries CSN1S2 (Additional file 2).

Initially, simplex PCR analyses of reference DNAs of each species were carried out and revealed that each new primer pair generated species-specific amplification, with no false positives observed in related species. Specifically, the Bubalus bubalis-specific primers (PRLRF and PRLRRdel7) (Additional file 2) amplified a 144 bp fragment from Bubalus bubalis DNA, with no amplification of Bos taurus, Ovis aries, or Capra hircus DNA. Similarly, the desired amplification (amplicon size of 162 bp) was obtained with only Ovis aries DNA when Ovis aries-specific primers (CSN1S2F and 3 CSN1S2del14) were used.

For the amplification of Capra hircus at the CSN1S1 locus and Bos taurus at the MSTN locus, the primer pairs developed for AS-PCR amplification were used (CSN1S1/CSN1S1ins28–183 bp and MSTN/MSTNdel16–211 bp, respectively) (Additional file 2).

Figure 4 shows the electrophoretic patterns of single species-specific amplification via the new primer pairs and the previously designed primers for CSN1S1 and MSTN.

Fig. 4
figure 4

Electrophoretic patterns of simplex species-specific amplification by using new (A and D) and previously designed (B and D) specific primer pairs. A) PRLR; B) MSTN; C) CSN1S1; D) CSN1S2. were from: Mediterranean river buffalo (patterns 1, 6, 10 and 14), Bos taurus (patterns 2, 5, 11 and 15), Capra hircus (patterns 3, 7, 9, 16), and Ovis aries (patterns 4, 8, 12 and 13). M: 1 kb Opti-DNA Marker, Applied Biological Materials

Full size image

To develop and validate the TetraS-PCR, a mixture of the four primer pairs (Additional file 2) and a mixture of reference DNA from different species were prepared. Briefly, the mixture of the four primer pairs was initially tested on reference DNA from each species and subsequently on 60 DNA mixtures each of two species (30 Capra hircus/Ovis aries and 30 Bubalus bubalis/Bos taurus) and 30 DNA mixtures each with all the investigated species.

The results of the TetraS-PCR assays revealed coamplification of specific fragments in a single PCR, with the sizes of the amplified products being consistent with those of the simplex PCR products. No non-specific bands were observed (Fig. 5).

Fig. 5
figure 5

Electrophoretic patterns of amplification products by TetraSS-PCR. Lane 1, Capra hircus (183 bp); line 2, Ovis aries (162 bp); line 3, Bos taurus (211 bp); line 4, Mediterranean river buffalo (144 bp). Lane 5, mixture of DNA from Capra hircus and Ovis aries; lane 6, mixture of DNA from Mediterranean river buffalo and Bos taurus; lane 7, DNA amplification products from Mediterranean river buffalo, Bos taurus, Capra hircus, and Ovis aries. M) 1 kb Opti-DNA Marker, Applied Biological Materials

Full size image

Limit of detection (LOD)

The sensitivity of the method for detecting DNA from each species in a mixture was evaluated. Briefly, a mixture of DNA from Capra hircus, Ovis aries, Bubalus bubalis, and Bos taurus was serially diluted to the same concentrations (0.1, 0.25, 0.5, 1, 5, 10, and 100 ng/μL) and analysed via multiplex SS‒PCR to determine the sensitivity of the multiplex PCR. The results revealed that the limit of DNA detection was 0.25 ng/μL. The same limit was reported by [19] for the identification of ruminant species in dairy products using PCR assays.

Discussion

InDels, like other genetic markers such as SNPs, are biallelic, codominant, abundant, and randomly distributed across genomes. When located in functional sequences, InDels are generally subject to stronger purifying selection than are SNPs. Long InDels and those affecting multiple functionally constrained nucleotides undergo stronger purifying selection [1]. One key advantage of InDels over SNPs is their lower likelihood of multiple mutations of the same length occurring at the same genomic position, making them useful for studying genetic relationships. Shared InDels represent identity by descent [20] and can serve as ancestry-informative markers, aiding in the study of population substructure, genetic diversity, phylogenetic relationships, genome evolution, and functional divergence [21].

Compared with SNPs, InDels contribute more significantly to sequence divergence, especially among closely related species [22, 23]. They are useful markers for population genetics, taxon diagnoses, forensic genetics, genetic mapping, association studies, and species identification [24,25,26,27].

Despite the advantages and broad applications of these markers, InDel studies remain underrepresented in the literature. Specifically, to our knowledge, no short genus- or species-specific short InDels have been identified in livestock ruminants to date. The only exception is the PRLR gene, which encodes the prolactin receptor, a member of the growth hormone/prolactin receptor gene family involved in various endocrine and reproductive functions [15].

The PRLR gene has been mapped to chromosome 19 in Bubalus bubalis (NC_059175.1 from 38,740,723 to 38,937,314), chromosome 20 in Bos taurus (NC_037347.1 from 38,915,987 to 39,108,971) and Capra hircus (NC_030827.1 from 38,891,738 to 39,090,307), and chromosome 16 in Ovis aries (NC_056069.1 from 39,248,092 to 39,250,921). It consists of 10 exons, with exons 1 and 2 being non-coding [15, 28, 29]. Two distinct PRLR isoforms are produced through alternative splicing of exon 10 of the primary transcript.

This last DNA coding region has been observed to accumulate a significant number of inter- and intraspecies polymorphisms across the different species investigated. Notably, a deletion of a CACTACC heptamer between nucleotides 1102 and 1103 of exon 10 has been identified as a genus-specific DNA marker for the genus Bubalus [15].

Since no short InDels specific to other widely distributed ruminant genera, such as Bos, Ovis, and Capra, have been reported, we conducted an extensive bibliographic review and comparative analysis of gene sequences from various mammalian species, focusing on key traits such as meat and milk production, which are highly conserved across species due to their fundamental role.

For instance, milk and mammary genes are highly conserved across all mammals, evolving more slowly along the lineage and subject to stronger selective constraints than most other genes in the genome. These genes have been shown to experience significant negative selection compared with the rest of the genome [30].

Among them, genes encoding the αs1 and αs2 casein fractions (CSN1S1 and CSN1S2, respectively) are known to influence both the qualitative and quantitative properties of milk in major ruminant and non-ruminant species of zootechnical interest. Due to their functional importance, structure, and variability, these genes serve as powerful molecular models for evolutionary research. They also provide insights into the genetic architecture of lesser-studied species and the phylogenetic relationships among mammalian species and domestic animals [18, 31,32,33,34,35,36]. Both genes have been annotated in nearly all species (https://www.ncbi.nlm.nih.gov/gene) and are particularly well characterized in Capra hircus, Bos taurus, Ovis aries and Bubalus bubalis. These genes share a similar organization among ruminants, although there are differences in intron size, mainly due to the varying distributions of artiodactyl retroposons located in introns and regulatory regions [17, 31, 32, 36,37,38,39,40,41]. The CSN1S1 and CSN1S2 genes are clustered with the β and k casein encoding genes (CSN2 and CSN3, respectively) in a 250 kb (kilobase) region on chromosome 6 in Capra hircus, Ovis aries and Bos taurus and on chromosome 7 in Bubalus bubalis [32]. An exception to this organization is found in certain mammals, such as donkeys, horses, rabbits, and rodents, which have an extra copy of the CSN1S2 gene, indicative of a recent paralogous gene duplication event [34, 42, 43].

The MSTN gene encodes myostatin, also known as growth differentiation factor 8 (GDF8), a negative regulator of skeletal muscle growth and size; therefore, its role in meat production is highly interesting. Mutations at this locus result in muscular hypertrophy and reduced fat, a phenomenon observed in ‘double muscled’ breeds of cattle and in several livestock and model species [44, 45]. The MSTN gene has been mapped to chromosome 2 in Bos taurus (NC_037329.1 from 6,278,864 to 6,285,491), Capra hircus (NC_030809.1 from 130,227,819 to 130,232,923, complement), Bubalus bubalis (NC_059158.1 from 58,423,897 to 58,428,995), and Ovis aries (NC_056055.1 from 119,285,858 to 119,292,614). This gene consists of three exons and two introns, and its sequence has been highly conserved across vertebrate species throughout evolution [46,47,48].

The deletion of a 16 bp DNA fragment at intron 1 of the MSTN gene identified in this study appears to be specific to Bos taurus compared to other species within the Bos genus (Bos grunniens, mutus, gaurus, frontalis and javanicus), as well as to species in the genera Bubalus, Capra, and Ovis (Additional file 7). In some Bos indicus breeds, such as Guanling, Weizhou, Weining, Lincanggaofeng, Brahman (an American zebuine × taurine hybrid beef cattle breed), and Qinchuan cattle [49, 50], comparative analysis revealed sequences with and without mutations from data available in GenBank. Furthermore, for the indicine Nelore and Gir cattle breeds, only one genomic sequence is available, and both lack the insertion. A single sequence containing the 16 bp DNA insertion is reported for Yunling cattle (Additional file 7).

All these variations could be due to the hybrid origin of these breeds [51,52,53,54,55,56,57,58,59,60]. Cattle are generally categorized into two major types: zebu (humped) and taurine (without humps), which are often classified as distinct species (Bos taurus indicus and Bos taurus taurus). However, due to their complete interfertility, they are frequently considered subspecies [61]. Genetic introgression (from Bos indicus to Bos taurus, but not the reverse) has been widely used to create new composite cattle populations, combining the climatic resilience of Bos taurus indicus with the relatively high dairy and meat productivity of Bos taurus taurus [62, 63].

For example, Chinese cattle are categorized into three groups on the basis of geographic distribution: southern, central and northern. The southern and northern groups primarily descend from Bos indicus and Bos taurus, respectively, whereas the central group originates from both [54]. Similarly, in Brazil, one of the world’s leading beef exporters, nearly 80% of the cattle herd is believed to have some degree of Bos indicus influence [64].

To further support the specificity of the InDel at the MSTN locus, a study on 722 Bos taurus cattle from ten different breeds (Hereford, Angus, South Devon, Composite, Charolais, Red Poll, Shorthorn, Simmental, Murray Grey) and cross-bred (Holstein–Friesian x Jersey) did not detect the insertion [65]. However, it was observed exclusively in the homozygous state by [66] in four different breeds of Bos indicus raised in India (Rathi, Deoni, Idduki and Vatakara).

Based on the findings from this study, the available data in GenBank, and the literature, the short InDels identified and characterized at the MSTN locus serve as effective markers for discriminating between Bos taurus and other species within the Bos genus.

In contrast, it is possible that the short InDels detected at the PRLR, CSN1S1, and CSN1S2 loci can serve as valid markers for discriminating between the genera Bubalus, Capra, and Ovis, respectively (Additional files 4, 5, and 10).

Among the various potential applications of genus- or species-specific InDels, one of the most practical is the development of protocols for the traceability of animal-derived products. Food adulteration, involving the admixture or substitution of high-value species-specific ingredients with less expensive, lower-quality ingredients, is an increasingly common issue. The inclusion of undeclared species in food ingredients can also trigger allergic reactions, posing a significant health risk to consumers [67, 68].

Currently, several analytical methods have been developed for food traceability [69, 70], but molecular analyses (DNA-based assays), due to their sensitivity, accuracy, and reproducibility, offer particularly valid tools [70, 71].

Only a few examples in the literature report the use of short and long interspersed repetitive elements as markers for DNA-based species identification [19, 72].

The genotyping of short InDel markers has several advantages. They are easier to analyse than SNPs, require less expensive procedures, and rely on equipment readly available in most laboratories [70].

Moreover, InDel markers are well suited for establishing protocols to identify hybrids through direct size separation of DNA fragments and are effective in amplifying and typing mixed or highly degraded DNA samples.

To identify genus/species-specific short Indels for ruminants, a TetraS-PCR assay was developed, employing four primer pairs, each designed to target distinct genes within a single reaction. A critical aspect of the setup of the TetraS-PCR system is the design of primers tailored to be species specific.

An undeniable advantage of this approach is the higher annealing efficiency of primers, stemming from their design based on species-specific InDel sequences. The selection of target regions containing InDels followed two main criteria: (a) short amplicon size to overcome amplification issues due to fragmented DNA in processed products and (b) significant yet comparable size differences among species-specific amplicons to allow clear and unambiguous separation via electrophoresis.

The proposed method, which is based on the detection of short InDels, allows for the simultaneous discrimination of Bubalus bubalis, Bos taurus, Capra hircus, and Ovis aries in animal-derived products or forensic samples.

Specifically, this method could be useful for discriminating between taurine and indicine meat, as well as identifying meats derived from various genetic combinations. Bos indicus beef is generally leaner, tougher, and of lower quality than Bos taurus [73]. As a result, some labelling systems exclude zebu meat from their certified brands, making robust species discrimination methods essential for maintaining consumer trust and product authenticity. Consequently, due to the increasing meat imports from countries where crossbreeding is widely practiced, it becomes crucial to have adequate tools to ensure the origin and quality of the meat.

Additionally, the proposed method can be a useful tool for detecting the adulteration of sheep milk with goat milk or the inclusion of cow milk in both. Fraudulent practices such as the adulteration of goat and sheep milk with cow milk are common. According to EU Directive No. 273/2008, the addition of cow milk to goat and sheep milk products is regulated, with a permissible limit set at 0.5%. Beyond the economic implications stemming from the high cost of sheep and goat milk, the primary risk for consumers lies in the unintentional consumption of proteins with high allergenic potential, such as bovine αs1 casein and β-lactoglobulin [74].

The relatively high cost and seasonal availability of buffalo milk are the main factors responsible for the well-known fraud related to “Mozzarella di Bufala Campana”, a typical Italian product certified by the European Protected Designation of Origin (PDO) (EC Regulation No. 1107/96 of 12 June 1996). Buffalo milk is characterized by a higher fat content (on average 8.0%) and casein concentration (averaging 36.7 mg/ml) than milk from other ruminants [75, 76]. Since the composition of milk from different species significantly influences cheese yield, flavour and sensory properties, adulterating the milk used in mozzarella production compromises the quality and sensory attributes of the final product, resulting in outcomes that are below consumer expectations.

Other potential applications of the proposed method include the detection of ruminant milk components in commercial milk from minor dairy species, such as equids (donkeys or horses) or camelids (dromedary and bactrian camels). These species produce milk that is nutritionally beneficial for human health, leading to a growing international interest in their health-promoting properties, including antibacterial and antiviral effects, as well as the diverse range of foods derived from their milk [34, 77]. As with the examples previously mentioned, the adulteration of such milk is often economically motivated, driven primarily by low milk production and the significant price difference between their milk and that of more common species, which may have a similar appearance and taste [78, 79].

The need for robust and reliable methods in animal forensic genetics is becoming increasingly critical due to the growing role of non-human DNA evidence in investigative contexts. The use of InDel markers can significantly contribute to forensic scenarios requiring species identification, including linking suspects, victims, and crime scenes; investigating animal attack; protecting wildlife; and combating illegal trade [80]. Moreover, differentiating between closely related species, such as Bos and Bubalus, especially in degraded samples, is also essential for advancing zooarchaeological studies [81].

In conclusion, this study provides new insights into the genetic differentiation among diverse group combinations, an area that remains underexplored. Finally, for the first time, a single genetic marker was identified and characterized, enabling the reliable distinction between taurine and zebu cattle at the DNA level.

Data availability

In this study no new DNA sequences and polymorphisms have been generated. The datasets used and analysed for in silico analyses were retrieved from the public repository https://www.ncbi.nlm.nih.gov/nuccore/?term= . The authors are available for any clarifications on the protocols developed.

Abbreviations

AS‒PCR:

Allele-specific PCR

CSN1S1 :

αS1-casein (gene)

CSN1S2 :

αS2-casein (gene)

CSN2 :

β Casein (gene)

InDels:

INsertions and DELetions

MSTN :

Myostatin (gene)

PCR:

Polymerase chain reaction

PRLR :

Prolactin receptor (gene)

SNPs:

Single Nucleotide Polymorphisms

TetraS-PCR:

Tetraplex-Specific PCR

TSS:

Target Species-Specific

References

  1. Montgomery SB, Goode DL, Kvikstad E, Albers CA, Zhang ZD, Mu XJ, et al. The origin, evolution, and functional impact of short insertion-deletion variants identified in 179 human genomes. Genome Res. 2013;23:749–61. https://doiorg.publicaciones.saludcastillayleon.es/10.1101/gr.148718.112.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  2. Barton HJ, Zeng K. The impact of natural selection on short insertion and deletion variation in the great Tit genome. GBE. 2019;11(6):1514–24. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/gbe/evz068.

    Article  PubMed  PubMed Central  Google Scholar 

  3. Perini S, Johannesson K, Butlin R, Westram AM. Short INDELs and SNPs as markers of evolutionary processes in hybrid zones. J Evol Biol. 2025;38(3):367–78. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/jeb/voaf002.

    Article  PubMed  Google Scholar 

  4. Mullaney JM, Mills RE, Pittard WS, Devine SE. Small insertions and deletions (INDELs) in human genomes. Hum Mol Genet. 2010;19(R2):R131–6. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/hmg/ddq400.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  5. Yang SL, Lin RY, Xu LX, Cheng L. Analysis of polymorphisms of mitochondrial DNA D-loop and Mc1R gene in Chinese Wuchuan Black cattle. J Appl Anim Res. 2014;42(4):487–91. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/09712119.2013.875917.

    Article  CAS  Google Scholar 

  6. Crespo-Piazuelo D, Criado-Mesas L, Revilla M, Castellò A, Fernàndez AI, Folch JM, et al. Indel detection from Whole Genome Sequencing data and association with lipid metabolism in pigs. PLoS ONE. 2019;14(6): e0218862. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0218862.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  7. Jiang J, Gao Y, Hou Y, Li W, Zhang S, Zhang Q, Sun D. Whole-genome resequencing of Holstein bulls for indel discovery and identification of genes associated with milk composition traits in dairy cattle. PLoS ONE. 2016;11(12): e0168946. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0168946.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  8. Jiang J, Liu L, Gao Y, Shi L, Li Y, Liang W, Sun D. Determination of genetic associations between indels in 11 candidate genes and milk composition traits in Chinese Holstein Population. BMC Genet. 2019;20:48. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12863-019-0751-y.

    Article  PubMed  PubMed Central  Google Scholar 

  9. Ju X, Huang X, Zhang M, Lan X, Wang D, Wei C, et al. Effects of eight InDel variants in FHIT on milk traits in Xinjiang brown cattle. Anim Biotechnol. 2020;32(4):486–94. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/10495398.2020.1724124.

    Article  CAS  PubMed  Google Scholar 

  10. Liu X, Fan X, Yan J, Zhang L, Wang L, Calnan H, et al. An InDel in the promoter of ribosomal protein S27-like gene regulates skeletal muscle growth in pigs. J Integr Agric. 2024. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.jia.2024.05.005.

    Article  Google Scholar 

  11. Ramunno L, Cosenza G, Pappalardo M, Pastore N, Gallo D, Di Gregorio P, et al. Identification of the goat CSN1S1F allele by means of PCR-RFLP method. Anim Genet. 2000;31(5):342–3. https://doiorg.publicaciones.saludcastillayleon.es/10.1046/j.1365-2052.2001.00054.x. Erratum. Anim Genet. 2000;32(1):54–54.

    Article  CAS  PubMed  Google Scholar 

  12. Ren T, Yang Y, LinW Li W, Xian M, Fu R, et al. A 31-bp indel in the 5’ UTR region of GNB1L is significantly associated with chicken body weight and carcass traits. BMC Genet. 2020;21(1):91. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12863-020-00900-z.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  13. Strychalski J, Czarnik U, Pierzchała M, Pareek CS. Relationship between the insertion/deletion polymorphism within the promoter and the intron 1 sequence of the PRNP gene and milk performance traits in cattle. Czech J Anim Sci. 2011;56(4):151–6. https://doiorg.publicaciones.saludcastillayleon.es/10.17221/1436-CJAS.

    Article  Google Scholar 

  14. Wang K, Yan H, Xu H, Yang Q, Zhang S, Pan C, et al. A novel indel within goat casein alpha S1 gene is significantly associated with litter size. Gene. 2018;671:161–9. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.gene.2018.05.119.

    Article  CAS  PubMed  Google Scholar 

  15. Cosenza G, Iannaccone M, Auzino B, Macciotta NPP, Kovitvadhi A, Nicolae I, Pauciullo A. Remarkable genetic diversity detected at river buffalo Prolactin Receptor (PRLR) gene and association studies with milk fatty acid composition. Anim Genet. 2018;49(3):159–68. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/age.12645.

    Article  CAS  PubMed  Google Scholar 

  16. Basic local alignment search tool. https://blast.ncbi.nlm.nih.gov/Blast.cgi. Accessed 14 Jan 2025.

  17. Ramunno L, Cosenza G, Rando A, Illario R, Gallo D, Di Berardino D, Masina P. The goat αs1-casein gene: gene structure and promoter analysis. Gene. 2004;334:105–11. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.gene.2004.03.006.

    Article  CAS  PubMed  Google Scholar 

  18. Pauciullo A, Versace C, Gaspa G, Letaief N, Bedhiaf-Romdhani S, Fulgione A, et al. Sequencing and characterization of αs2-Casein gene (CSN1S2) in the old-world camels have proven genetic variations useful for the understanding of species diversification. Animals. 2023;13(17): 2805. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/ani13172805.

    Article  PubMed  PubMed Central  Google Scholar 

  19. Cosenza G, Iannaccone M, Gallo D, Pauciullo A. A fast and reliable polymerase chain reaction method based on short interspersed nuclear elements detection for the discrimination of buffalo, cattle, goat, and sheep species in dairy products. AJAS. 2019;32(6):891–5. https://doiorg.publicaciones.saludcastillayleon.es/10.5713/ajas.18.0459.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  20. Kim JY, Hwang JE, Eo SH, Kang SG, Moon JC, Kim JA, et al. Development of InDel markers for interspecific hybridization between hill pigeons and feral pigeons based on whole-genome re-sequencing. Sci Rep. 2022;12(1):22618. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41598-022-27147-1.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  21. Luan PT, Ryder OA, Davis H, Zhang YP, Yu L. Incorporating indels as phylogenetic characters: impact for interfamilial relationships within Arctoidea (Mammalia: Carnivora). Mol Phylogenet Evol. 2013;66(3):748–56. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ympev.2012.10.023.

    Article  PubMed  Google Scholar 

  22. Britten RJ. Divergence between samples of chimpanzee and human DNA sequences is 5%, counting indels. PNAS. 2002;99(21):13633–5. https://doiorg.publicaciones.saludcastillayleon.es/10.1073/pnas.172510699.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  23. Britten RJ, Rowen L, Williams J, Cameron RA. Majority of divergence between closely related DNA samples is due to indels. PNAS. 2003;100(8):4661–5. https://doiorg.publicaciones.saludcastillayleon.es/10.1073/pnas.0330964100.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  24. Almheiri M, Sanqoor S, Haidar M, Nazir M, Vijayan R. Study of insertion-deletion polymorphisms (indels) in the UAE population. Forensic Sci Int Genet. 2019;7(1):561–3. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.fsigss.2019.10.090.

    Article  Google Scholar 

  25. Chen FC, Chen CJ, Chuang TJ. INDELSCAN: a web server for comparative identification of species-specific and non-species-specific insertion/deletion events. Nucleic Acids Res. 2007;35(2):W633-638. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/gkm350.

    Article  PubMed  PubMed Central  Google Scholar 

  26. Martín P, García O, Heinrichs B, Yurrebaso I, Aguirre A, Alonso A. Population genetic data of 30 autosomal indels in Central Spain and the Basque Country populations. Forensic Sci Int Genet. 2013;7(2):e27-30. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.fsigen.2012.10.003.

    Article  CAS  PubMed  Google Scholar 

  27. Väli U, Brandström M, Johansson M, Ellegren H. Insertion-deletion polymorphisms (indels) as genetic markers in natural populations. BMC Genet. 2008;9: 8. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/1471-2156-9-8.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  28. El-Magd MA, Fathy A, Kahilo KA, Saleh AA, El Sheikh AI, Al-Shami S, El-Komy SM. Polymorphisms of the PRLR gene and their association with milk production traits in Egyptian buffaloes. Animals. 2021;11(5): 1237. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/ani11051237.

    Article  PubMed  PubMed Central  Google Scholar 

  29. Hayes H, Le CC, Goubin G, Mercier D, Payen EJ, Bignon C, et al. Localization of ZNF164, ZNF146, GGTA1, SOX2, PRLR and EEF2 on homeologous cattle, sheep, and goat chromosomes by fluorescent in situ hybridization and comparison with human gene map. Cytogen Cell Genet. 1996;72:342–6. https://doiorg.publicaciones.saludcastillayleon.es/10.1159/000134218.

    Article  CAS  Google Scholar 

  30. Lemay DG, Lynn DJ, Martin WF, Neville MC, Casey TM, Rincon G, et al. The bovine lactation genome: insights into the evolution of mammalian milk. Genome Biol. 2009;10(4): R43. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/gb-2009-10-4-r43.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  31. Cosenza G, Pauciullo A, Macciotta NPP, Apicella E, Steri R, La Battaglia A, et al. Mediterranean River Buffalo CSN1S1 gene: search for polymorphisms and association studies. Anim Prod Sci. 2015;55(5):654–60. https://doiorg.publicaciones.saludcastillayleon.es/10.1071/AN13438.

    Article  CAS  Google Scholar 

  32. Cosenza G, Gallo D, Auzino B, Gaspa G, Pauciullo A. Complete CSN1S2 characterization, novel alleles identification and association with milk fatty acids composition in river buffalo. Front Genet. 2021;11: 622494. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fgene.2020.622494.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  33. Kawasaki K, Lafont AG, Sire JY. The evolution of milk casein genes from tooth genes before the origin of mammals. MBE. 2011;28:2053–61. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/molbev/msr020.

    Article  CAS  Google Scholar 

  34. Cosenza G, Pauciullo A. A comprehensive analysis of CSN1S2 I and II transcripts reveals significant genetic diversity and allele-specific exon skipping in Ragusana and Amiatina Donkeys. Animals. 2024;14(20): 2918. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/ani14202918.

    Article  PubMed  PubMed Central  Google Scholar 

  35. Rahmatalla SA, Arends D, Brockmann GA. Review: genetic and protein variants of milk caseins in goats. Front genet. 2022;13: 995349. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fgene.2022.995349.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  36. Rehman SU, Feng T, Wu S, Luo X, Lei A, Luobu B, Hassan FU, Liu Q. Comparative genomics, evolutionary and gene regulatory regions analysis of Casein Gene Family in Bubalus bubalis. Front genet. 2021;12: 662609. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fgene.2021.662609.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  37. Calvo JH, Dervishi E, Sarto P, González-Calvo L, Berzal-Herranz B, Molino F, Serrano M, et al. Structural and functional characterisation of the αS1-casein (CSN1S1) gene and association studies with milk traits in Assaf sheep breed. Livest Sci. 2013;157:1–8. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.livsci.2013.06.014.

    Article  Google Scholar 

  38. Groenen M, Dijkhof R, Verstege A, Van der Poel J. The complete sequence of the gene encoding bovine α2-casein. Gene. 1993;123(2):187–93. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/0378-1119(93)90123-k.

    Article  CAS  PubMed  Google Scholar 

  39. Koczan D, Hobom G, Seyfert HM. Genomic organization of the bovine alpha-S1 casein gene. Nucleic Acids Res. 1991;19:5591–6. https://doiorg.publicaciones.saludcastillayleon.es/10.1093/nar/19.20.5591.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  40. Rijnkels M. Multispecie comparison of the casein gene loci and evolution of casein gene family. J Mammary Gland Biol Neoplasia. 2002;7:327–45. https://doiorg.publicaciones.saludcastillayleon.es/10.1023/a:1022808918013.

    Article  PubMed  Google Scholar 

  41. Stafuzza NB, Naressi BCM, Amaral-Trusty MEJ. Sequence analysis of the alpha-s1 casein gene in Murrah buffalo. 52a Reunião Anual da Sociedade Brasileira de Zootecnia. Belo Horizonte. 2015. Available from: https://www.researchgate.net/publication/319143582_Sequence_analysis_of_the_alpha-s1_casein_gene_in_Murrah_buffalo.

  42. Auzino B, Miranda G, Henry C, Krupova Z, Martini M, Salari F, et al. Top-Down proteomics based on LC-MS combined with cDNA sequencing to characterize multiple proteoforms of Amiata donkey milk proteins. Food Res Int. 2022;160: 111611. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.foodres.2022.111611.

    Article  CAS  PubMed  Google Scholar 

  43. Cosenza G, Pauciullo A, Annunziata AL, Rando A, Chianese L, Marletta D, et al. Identification and characterization of the donkey CSN1S2 I and II cDNAs. Ita J Anim Sci. 2010;9(e40):206–11. https://doiorg.publicaciones.saludcastillayleon.es/10.4081/ijas.2010.e40.

    Article  Google Scholar 

  44. Kocamis H, Killefer J. Myostatin expression and possible functions in animal muscle growth. Domest Anim Endocrinol. 2002;23:447–54. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/s0739-7240(02)00178-9.

    Article  CAS  PubMed  Google Scholar 

  45. Baig MH, Ahmad K, Moon JS, Park SY, Ho Lim J, Chun HJ, et al. Myostatin and its regulation: a comprehensive review of myostatin inhibiting strategies. Front Physiol. 2022;13: 876078. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fphys.2022.876078.

    Article  PubMed  PubMed Central  Google Scholar 

  46. Abdel-Aziem SH, Mahrous KF, Abd El-Hafez MAM, Abdel MM. Genetic variability of myostatin and prolactin genes in popular goat breeds in Egypt. JGEB. 2018;16(1):89–97. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.jgeb.2017.10.005.

    Article  Google Scholar 

  47. Grobet L, Martin LJ, Poncelet D, Pirottin D, Brouwers B, Riquet J, et al. A deletion in the bovine myostatin gene causes the double-muscled phenotype in cattle. Nat Genet. 1997;17(1):71–4. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/ng0997-71.

    Article  CAS  PubMed  Google Scholar 

  48. Osman NM, Shafey HI, Abdelhafez MA, Sallam AM, Mahrous KF. Genetic variations in the Myostatin gene affecting growth traits in sheep. Vet World. 2021;14(2):475–82. https://doiorg.publicaciones.saludcastillayleon.es/10.14202/vetworld.2021.475-482.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  49. He YL, Wu Y, Lan Z, Liu Y, Zhang Y. Molecular analysis of the first intron in the bovine myostatin gene. Mol Biol Rep. 2011;38(7):4643–9. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s11033-010-0598-9.

    Article  CAS  PubMed  Google Scholar 

  50. He YL, Wu YH, Quan FS, Liu YG, Zhang Y. Comparative analysis of myostatin gene and promoter sequences of Qinchuan and Red Angus cattle. GMR. 2013;12(3):3398–406. https://doiorg.publicaciones.saludcastillayleon.es/10.4238/2013.

    Article  CAS  PubMed  Google Scholar 

  51. Liu RY, Xia XL, Lei CZ, Zhang MZ, Chen H, Yang GS. Genetic diversity of mitochondrial DNA D-loop sequences in cattle breeds in Guizhou. Hereditas. 2006;28:279–84.

    PubMed  Google Scholar 

  52. O’Brien AMP, Höller D, Boison SA, Milanesi M, Bomba L, Utsunomiya YT, et al. Low levels of taurine introgression in the current Brazilian Nelore and Gir indicine cattle populations. GSE. 2015;47:31. https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12711-015-0109-5.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  53. Koufariotis L, Hayes BJ, Kelly M, Burns BM, Lyons R, Stothard P, et al. Sequencing the mosaic genome of Brahman cattle identifies historic and recent introgression including polled. Sci Rep. 2018;8(1):17761. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41598-018-35698-5.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  54. Chen N, Huang J, Zulfiqar A, Li R, Xi Y, Zhang M, et al. Population structure and ancestry of Qinchuan cattle. Anim Genet. 2018;49(3):246–8. https://doiorg.publicaciones.saludcastillayleon.es/10.1111/age.12658.

    Article  CAS  PubMed  Google Scholar 

  55. Amancio AP, Duarte SSM, Silva RC, da Cruz AS, Silva DC, da Silva CC, da Cruz AD. Banded karyotype of Nelore cattle (Bos taurus indicus Linnaeus, 1758). Comp Cytogenet. 2019;13(3):265–75. https://doiorg.publicaciones.saludcastillayleon.es/10.3897/CompCytogen.v13i3.36449.

    Article  PubMed  PubMed Central  Google Scholar 

  56. Xia X, Qu K, Li F, Jia P, Chen Q, Chen N, et al. Abundant genetic diversity of Yunling Cattle based on mitochondrial genome. Animals. 2019;9(9): 641. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/ani9090641.

    Article  PubMed  PubMed Central  Google Scholar 

  57. Wang X, Ju Z, Jiang Q, Zhong J, Liu C, Wang J, et al. Introgression, admixture, and selection facilitate genetic adaptation to high-altitude environments in cattle. Genomics. 2021;113(3):1491–503. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.ygeno.2021.03.023.

    Article  CAS  PubMed  Google Scholar 

  58. Liu Y, Cheng H, Wang S, Luo X, Ma X, Sun L, et al. Genomic diversity and selection signatures for Weining cattle on the border of Yunnan-Guizhou. Front Genet. 2022;13: 848951. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fgene.2022.848951.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  59. Milanesi M, Obrien AMP, Utsunomiya AT, Feres LF, Sonstegard TS, Garcia JF. Genomic breed composition of pure registered Brazilian Gir. Trop Anim Health Prod. 2022;54(5):310. https://doiorg.publicaciones.saludcastillayleon.es/10.1007/s11250-022-03299-0.

    Article  CAS  PubMed  Google Scholar 

  60. Dai X, Bian P, Hu D, Luo F, Huang Y, Jiao S, et al. A Chinese indicine pangenome reveals a wealth of novel structural variants introgressed from other Bos species. Genome Res. 2023;33(8):1284–98. https://doiorg.publicaciones.saludcastillayleon.es/10.1101/gr.277481.122.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  61. Loftus RT, MacHugh DE, Bradley DG, Sharp PM, Cunningham P. Evidence for two independent domestications of cattle. PNAS. 1994;91(7):2757–61. https://doiorg.publicaciones.saludcastillayleon.es/10.1073/pnas.91.7.2757.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  62. Vahedi SM, Salek Ardestani S, Pahlevan Afshari K, Ghoreishifar SM, Moghaddaszadeh-Ahrabi S, Banabazi MH, et al. Genome-wide selection signatures and human-mediated introgression events in Bos taurus indicus-influenced composite beef cattle. Front Genet. 2022;13: 844653. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fgene.2022.844653.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  63. Zhang Q, Schönherz AA, Lund MS, Guldbrandtsen B. Positive selection and adaptive introgression of haplotypes from Bos indicus improve the modern Bos taurus cattle. Agriculture. 2022;12: 844. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/agriculture12060844.

    Article  CAS  Google Scholar 

  64. Bressan MC, Rodrigues EC, Rossato LV, Neto-Fonseca I, Alves SP, Bessa RJB, et al. Discrimination of meat produced by Bos taurus and Bos indicus finished under an intensive or extensive system. Animals (Basel). 2020;10(10): 1737. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/ani10101737.

    Article  PubMed  PubMed Central  Google Scholar 

  65. Haruna IL, Ekegbu UJ, Ullah F, Amirpour-Najafabadi H, Zhou H, Hickford JGH. Genetic variations and haplotypic diversity in the Myostatin gene of New Zealand cattle breeds. Gene. 2020;740: 144400. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.gene.2020.144400.

    Article  CAS  PubMed  Google Scholar 

  66. Tantia MS, Vijh RK, Kumar ST, Mishra B, Reecy JM. Comparative analysis of GDF 8 (myostatin) in Bos indicus and Bos taurus. DNA Seq. 2006;17(4):311–3. https://doiorg.publicaciones.saludcastillayleon.es/10.1080/10425170600807603.

    Article  CAS  PubMed  Google Scholar 

  67. Chaudhary V, Kajla P, Dewan A, Pandiselvam R, Socol CT, Maerescu CM. Spectroscopic techniques for authentication of animal origin foods. Front nutr. 2022;9: 979205. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fnut.2022.979205.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  68. Zhou S, Zhong G, Zhou H, Zhang X, Zeng X, Wu Z, et al. A heptaplex PCR Assay for molecular traceability of species origin with high efficiency and practicality in both raw and heat processing meat materials. Front nutr. 2022;23(9): 890537. https://doiorg.publicaciones.saludcastillayleon.es/10.3389/fnut.2022.890537.

    Article  CAS  Google Scholar 

  69. Danezis GP, Tsagkaris AS, Camin F, Brusic V, Georgiou CA. Food authentication: techniques, trends and emerging approaches. Trends Anal Chem. 2016;85:123–32. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.trac.2016.02.026.

    Article  CAS  Google Scholar 

  70. Mafra I, Honrado M, Amaral JS. Animal species authentication in dairy products. Foods. 2022;11(1124):10.3390/foods11081124.

    Google Scholar 

  71. Lo YT, Shaw PC. DNA-based techniques for authentication of processed food and food supplements. Food Chem. 2018;240:767–74. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.foodchem.2017.08.022.

    Article  CAS  PubMed  Google Scholar 

  72. Tajima K, Enishi O, Amari M, Mitsumori M, Kajikawa H, Kurihara M, et al. PCR detection of DNAs of animal origin in feed by primers based on sequences of short and long interspersed repetitive elements. Biosci Biotechnol Biochem. 2002;66(10):2247–50. https://doiorg.publicaciones.saludcastillayleon.es/10.1271/bbb.66.2247.

    Article  CAS  PubMed  Google Scholar 

  73. Rodrigues RT, Chizzotti ML, Vital CE, Baracat-Pereira MC, Barros E, Busato KC, et al. Differences in Beef Quality between Angus (Bos taurus taurus) and Nellore (Bos taurus indicus) cattle through a proteomic and phosphoproteomic approach. PLoS ONE. 2017;12(1): e0170294. https://doiorg.publicaciones.saludcastillayleon.es/10.1371/journal.pone.0170294.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  74. Calvano CD, De Ceglie C, Monopoli A, Zambonin CG. Detection of sheep and goat milk adulterations by direct MALDI-TOF MS analysis of milk tryptic digests. J Mass Spectrom. 2012;47(9):1141–9. https://doiorg.publicaciones.saludcastillayleon.es/10.1002/jms.2995.

    Article  CAS  PubMed  Google Scholar 

  75. Correddu F, Serdino J, Manca MG, Cosenza G, Pauciullo A, Ramunno L, et al. Use of multivariate factor analysis to characterize the fatty acid profile of buffalo milk. J Food Compos Anal. 2017;60:25–31. https://doiorg.publicaciones.saludcastillayleon.es/10.1016/j.jfca.2017.03.008.

    Article  CAS  Google Scholar 

  76. Cosenza G, Mauriello R, Garro G, Auzino B, Iannaccone M, Costanzo A, et al. Casein composition and differential translational efficiency of casein transcripts in donkey’s milk. Res J Dairy Sci. 2019;86(2):201–7. https://doiorg.publicaciones.saludcastillayleon.es/10.1017/S0022029920000035. Erratum 2020: Res J Dairy Sci. 2020;87(1):141.

    Article  CAS  Google Scholar 

  77. Vincenzetti S, Cammertoni N, Rapaccetti R, Santini G, Klimanova Y, Zhang JJ, Polidori P. Nutraceutical and functional properties of Camelids’ milk. Beverages. 2022;8: 12. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/beverages8010012.

    Article  CAS  Google Scholar 

  78. Hai X, Liu GQ, Luo JX, Guo YS, Qian JP, Ya M, et al. Triplex real-time PCR assay for the authentication of camel-derived dairy and meat products. JDS. 2020;103(11):9841–50. https://doiorg.publicaciones.saludcastillayleon.es/10.3168/jds.2019-17245.

    Article  CAS  Google Scholar 

  79. Wu X, Na Q, Hao S, Ji R, Ming L. Detection of ovine or bovine milk components in commercial camel milk powder using a PCR-Based method. Molecules. 2022;27(9): 3017. https://doiorg.publicaciones.saludcastillayleon.es/10.3390/molecules27093017.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

  80. Gao HY, Liu GF, Wu J, Chen PY. Animal DNA Typing and Its Research Progress in Forensic Medicine. Fa Yi Xue Za Zhi. 2023;39(2):161–167 https://doiorg.publicaciones.saludcastillayleon.es/10.12116/j.issn.1004-5619.2021.511210.

  81. Pei X, Liang F, Cao Y, Zhang Y. The dynamics of Bovini exploitation strategies on the Central Plains of China from the middle neolithic to the bronze age. Sci Rep. 2024;14(1):29616. https://doiorg.publicaciones.saludcastillayleon.es/10.1038/s41598-024-81065.

    Article  CAS  PubMed  PubMed Central  Google Scholar 

Download references

Acknowledgements

None.

Funding

This research was funded by the Italian Ministry of University and Research (D.D. 1332) through the project PON01_00486 (Sequenziamento del genoma bufalino per il miglioramento qualiquantitativo delle produzioni agro-alimentari–GENOBU). Agritech National Research Center of the European Union Next-Generation EU (Piano Nazionale di Ripresa e Resilienza -PNRR- Missione 4 Componente 2, Investimento 1.4-D.D. 1032 17/06/2022, CN00000022) also funded the study.

Author information

Author notes

  1. Gianfranco Cosenza and Andrea Fulgione contributed equally to this work.

Authors and Affiliations

  1. Department of Agricultural Science, University of Naples Federico II, Piazza Carlo Di Borbone 1, Portici, 80055, Italy

    Gianfranco Cosenza, Andrea Fulgione & Daniela Gallo

  2. Department of Veterinary Medicine and Animal Production, University of Naples Federico II, Via Delpino 1, Naples, 80137, Italy

    Sara Albarella, Francesca Ciotola & Vincenzo Peretti

  3. Department of Agricultural, Forest and Food Sciences, University of Turin, Grugliasco, 10095, Italy

    Alfredo Pauciullo

Authors
  1. Gianfranco Cosenza
    View author publications

    You can also search for this author inPubMed Google Scholar

  2. Andrea Fulgione
    View author publications

    You can also search for this author inPubMed Google Scholar

  3. Sara Albarella
    View author publications

    You can also search for this author inPubMed Google Scholar

  4. Francesca Ciotola
    View author publications

    You can also search for this author inPubMed Google Scholar

  5. Vincenzo Peretti
    View author publications

    You can also search for this author inPubMed Google Scholar

  6. Daniela Gallo
    View author publications

    You can also search for this author inPubMed Google Scholar

  7. Alfredo Pauciullo
    View author publications

    You can also search for this author inPubMed Google Scholar

Contributions

G.C. and A.F. conceived, designed and performed the experiments. A.P., A.F., and G.C. analysed the data. G.C., A.P., S.A., and F.C. wrote the manuscript. A.F., D.G., V.P., and G.C. contributed reagents, materials, and analysis tools. A.F., S.A., V.P., and F.C. revised the article critically for important intellectual content. G.C., A.P., A.F., S.A., F.C., V.P., and D.G. gave final approval of the version to be published.

Corresponding author

Correspondence to Sara Albarella.

Ethics declarations

Ethics approval and consent to partecipate

All DNA samples used in this study were obtained from the DNA collections of the University of Naples Federico II and the University of Turin. The original biological tissue used for DNA isolation was blood, which was collected by an official veterinarian from the ASL (Local Sanitary Unit) of the Italian Ministry of Health during routine treatments in accordance with Italian national regulations on animal welfare. Therefore, approval from the Animal Care and Use Committee (Legislative Decree No. 26 of March 4, 2014, Implementation of Directive 2010/63/EU on the Protection of Animals Used for Scientific Purposes) was not required.

Consent for publication

All the authors have read and agreed to the published version of the manuscript.

Competing interests

The authors declare no competing interests.

Additional information

Publisher’s Note

Springer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.

Supplementary Information

Additional file 1: Table 1: Gene target, primer sequence, amplified species and amplicon size of AS-PCRs.

Additional file 2: Table 2: Gene target, primer sequence and amplicon size of Tetraplex Specie-Specific PCR.

12917_2025_4694_MOESM3_ESM.pdf

Additional file 3: Fig. 1: Comparison of the partial proximal CSN1S1 promoter sequences of representative species from the Artiodactyla and Perissodactyla orders. The dashes represent nucleotides identical to those in the upper lines. The short InDels are highlighted in gray, TGTACAA repetitions are in bold, and duplications are underlined. 1: Capra hircus (GenBank KC951931.1 from 1943 to 2062); Capra ibex (GenBank SJYO01041852.1 from 71532893 to 71533011); Capra aegagrus (GenBank CBYH010035613.1 from 223376 to 223494); Capra falconeri (GenBank JAWPPH010101386.1 from 2986 to 3104, complement); 2: Ovis aries (GenBank JN701803.1 from 25 to 136); Ovis ammon (GenBank NIWH01032118.1 from 68020430 to 68020541); 3: Bubalus bubalis breed Mediterranean (GenBank AWWX01570220.1 from 20546 to 20642), Bubalus bubalis breed Murrah (GenBank AF529305.2 from 1027 to 1124), Bubalus kerabau breed swamp (GenBank JARFXY010000007.1 from 89615493 to 89615589), Bubalus depressicornis (GenBank JAMXBS010096084.1 from 20891 to 20987), and Bos grunniens (GenBank VBZB01000005.1 from 35968966 to 35969062); 4: Bos taurus (GenBank X59856.2 from 9464 to 9561), and Bos indicus (GenBank JASFDU010376321.1 from 1210 to 1307); 5: Rangifer tarandus (GenBank OX596114.1 from 19755123 to 19755217); 6: Cervus elaphus (GenBank OU343083.1 from 30458569 to 30458663); 7: Camelus dromedarius (GenBank LSZX01093722.1 from 59067 to 59161), and Camelus ferus (GenBank AGVR01039100.1 from 241242 to 241336); 8: Lama glama (GenBank PNXU01093137.1 from 152525 to 152619), and Vicugna pacos (GenBan ABRR03000026.1 from 54448393 to 54448487); 9: Sus scrofa (GenBank EU025875.1 6815 to 6915);10: Ceratotherium simum (GenBank PVLE01002027.1 from 8152 to 8251); 11:Tapirus indicus (GenBank PVIE01006105.1 from 63615 to 63715).

12917_2025_4694_MOESM4_ESM.pdf

Additional file 4: Table 3 In silico species-specific InDel identification at the CSN1S1 locus in ruminant species. The specific insertion for the genus Capra is highlighted in gray, and the deletion specific for the genus Ovis is in bold.

12917_2025_4694_MOESM5_ESM.pdf

Additional file 5: Table 4 In silico species-specific InDel identification at the CSN1S2 locus in the genera Capra, Ovis, Bubalus, and Bos. The specific deletion for the genus Ovis is highlighted in gray.

12917_2025_4694_MOESM6_ESM.pdf

Additional file 6: Fig. 2 Comparison of CSN1S2 partial intron 1 nucleotide sequences of representative species belonging to the Artiodactyla and Perissodactyla orders. The dashes represent nucleotides identical to those in the upper lines. The short InDels are highlighted in gray. 1: Ovis aries (GenBank KT283354.1 from 610 to 696); 2: Ovis aries (GenBank JAWMPZ010000006.1 from 91390711 to 91390797); 3: Capra hircus (GenBank LWLT01000006.1 from 86078347 to 86078447); 4: Bubalus bubalis (Mediterranean GenBank MW159135.1 from 2404 to 2504, and Murrah GenBank VDCC01000007.1 from 32346792 to 32346892); 5: Bubalus bubalis (Mediterranean breed GenBank MW159136.1 from 2393 to 2493); 6: Bubalus bubalis (Kerabau swamp GenBank JARFXY010000007.1 from 89744003 to 89744103, and Depressicornis GenBank JAMXBS010059713.1 from 4606 to 4706); 7: Bos taurus (GenBank M94327.1 from 3584 to 3684); 8: Bos indicus (GenBank PRDE01000026.1 from 87254016 to 87254116); 9: Bos grunniens (GenBank VBZB01000005.1 from 35840127 to 35840227); 10: Rangifer tarandus (GenBank OX596114.1 from 19874491 to 19874593), and Cervus elaphus (GenBank OU343083.1 from 30339433 to 30339535, complement); 11: Muntiacus reevesi (GenBank OZ005646.1 from 30071163 to 30071265); 12: Sus scrofa (GenBank LUXU01069711.1 from 564154 to 564256); 13: Equus caballus (GenBank JAPJZS010003086.1 from 51148228 to 51148330), Equus asinus (GenBank JREZ01000259.1 from 17762 to 17864), and Equus quagga (GenBank JAKJSB010001568.1 from 100903916 to 100904018, complement); 14: Ceratotherium simum (GenBank AKZM01002854.1 from 54353 to 54455); 15: Tapirus indicus (GenBank JAVSPQ010000004.1 from 54488574 to 54488676).

12917_2025_4694_MOESM7_ESM.pdf

Additional file 7: Table 5 In silico species-specific InDel identification at the MSTN locus in the genera Capra, Ovis, Bubalus, and Bos. The specific deletion for Bos taurus is highlighted in gray.

12917_2025_4694_MOESM8_ESM.pdf

Additional file 8: Fig. 3 Comparison of the partial MSTN intron 1 nucleotide sequences of representative species belonging to the Artiodactyla and Perissodactyla orders. The dashes represent nucleotides identical to those in the upper lines. The short InDels are highlighted in gray. 1: Bos taurus (GenBank AB076403.1 from 1159 to 1262), and Bos indicus x Bos taurus hybrids (GenBank PUFT02000002.1 from 127935602 to 127935705); 2: Bos grunniens (GenBank JN642607.1 from 1097 to 1216), Bos mutus (GenBank VBQZ03000004.1 from 47972658 to 47972777), Bos frontalis (GenBank RBVW01003794.1 from 79189 to 79308), Bos javanicus (GenBank JAVLEU010000002.1 from 6312509 to 6312628), Bos gaurus (GenBank JACAOC010000017.1 from 1124918 to 1125037), Bos indicus (GenBank AY794986.1 from 1159 to 1278), Bos indicus x Bos taurus hybrids (GenBank PUFS02000002.1 from 6036628 to 6036747), Bison bison (GenBank JPYT01086742.1 from 5189 to 5308), and Bos taurus breed Yunling (GenBank JAWKDW010000003.1 from 131646859 to 131646740, complement); 3: Bubalus kerabau breed swamp (GenBank JARFXY010000003.1 from 59857473 to 59857592), and Bubalus depressicornis (GenBank JAMXBS010027670.1 from 21336 to 21455); 4: Bubalus bubalis breed Mediterranean (GenBank DQ091762.1 from 1065 to 1184), and Bubalus bubalis breed Murrah (GenBank VDCC01000002.1 from 58035442 to 58035561); 5: Rangifer tarandus (GenBank OX596096.1 from 68947317 to 68947436), and Cervus elaphus (GenBank OU343110.1 from 10575652 to 10575771); 6: Ovis aries (GenBank MH025940.1 from 2210 to 2329), and Capra hircus (GenBank JX078969.1 from 1224 to 1343); 7: Camelus dromedarius (GeneBan LSZX01094446.1 from 13519 to 13638), Camelus ferus (GeneBanVSZR01000033.1  from 59262525 to 59262644), and Camelus bactrianus (GenBank CAOW010387223.1 from 1829 to 1948); 8: Lama glama (GeneBan PNXU01000637.1 from 236134 to 236253), and Vicugna pacos (GenBank JEMW01017296.1 from 84546 to 84665); 9: Sus scrofa (GenBank EF490990.1 from 2235 to 2353); 10: Equus caballus (GenBank KY746357.1 from 1645 to 1763); 11: Equus asinus (GenBank JADWZW020000004.1 from 25419042 to 25419156); 12: Equus quagga (GenBank JAKJSB010006700.1 from 8862462 to 8862576, complement); 13: Ceratotherium simum (GenBank PVLE01086917.1 from 2942 to 3062); 14: Tapirus indicus (GenBank PVIE01000017.1 from 143272 to 143391).

12917_2025_4694_MOESM9_ESM.pdf

Additional file 9: Fig. 4 Comparison of the PRLR sequences of partial exon 10 with the homologous sequences available in the database for the main species belonging to the Artiodactyla and Perissodactyla orders. The dashes represent nucleotides identical to those in the upper lines. The short Indels are highlighted in gray. 1: Bubalus bubalis (Mediterranean, GenBank MF461277.1 from 12141 to 12193, Murrah GenBank XM_025270632.3 from 2207 to 2259, Kerabau swamp, GenBank JARFXY010000018.1 from 40954223 to 40954275, Depressicornis, GenBank JAMXBS010060037.1 from 50052 to 50104, and Syncerus caffer, GenBank SJXX02054938.1 from 1119837 to 1119889, complement); 2: Bos taurus (GenBank OY997248.1 from 42476450 to 42476509), Bos indicus (GenBank XM_019983032.1 from 2188 to 2247), Bos javanicus (GenBank XM_061393756.1 from 2862 to 2921), Bos mutus (GenBank XM_005907371.2 from 1947 to 2006), and Bison bison (GenBank XM_010853807.1 from 2122 to 2181); 3: Tragelaphus oryx (GenBank SJYK013989325.1 from 1715 to 1774, complement); 4: Capra hircus (GenBank XM_061393756.1 from 2759 to 2818), and Ovis aries (GenBank KC734660.1 from 503 to 562); 5: Cervus elaphus (GenBank XM_043887317.1 from 2217 to 2278), and Rangifer tarandus (GenBank OX459950.2 from 41714039 to 41714100); 6: Camelus dromedarius (GenBank XM_031443888.1 from 2286 to 2349), Camelus ferus (GenBank XM_006194514.3 from 2238 to 2301), and Camelus bactrianus (GenBank XM_010955538.2 from 2224 to 2287); 7: Vicugna pacos (GenBank XM_006199659.3 from 2235 to 2298); 8: Lama glama (GenBank DQ206831 from 1068 to 1127); 9: Sus scrofa (GenBank HM059030.1 from 1105 to 1169); 10: Equus asinus (GenBank XM_014831229.2 from 2492 to 2549), and Equus quagga (GenBank XM_046671632.1 from 2414 to 2477; 11: Equus caballus (GenBank XM_001500104.4 from 2757 to 2820); 12: Ceratotherium simum simum (GenBank XM_014781582.1 from 2216 to 2279); 13: Tapirus indicus (GenBank JAVSPQ010000006.1 from 118655899 to 118655962).

12917_2025_4694_MOESM10_ESM.pdf

Additional file 10: Table 6: In silico species-specific InDel identification at the PRLR locus in the genera Capra, Ovis, Bubalus, and Bos. The specific deletion for the genus Bubalus is highlighted in gray.

Additional file 11: Uncropped gels used for Figure 1, 2, 3, 4 and 5.

Rights and permissions

Open Access This article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/.

Reprints and permissions

About this article

Check for updates. Verify currency and authenticity via CrossMark

Cite this article

Cosenza, G., Fulgione, A., Albarella, S. et al. Identification and Validation of Genus/Species-Specific Short InDels in Dairy Ruminants. BMC Vet Res 21, 215 (2025). https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12917-025-04694-z

Download citation

  • Received:

  • Accepted:

  • Published:

  • DOI: https://doiorg.publicaciones.saludcastillayleon.es/10.1186/s12917-025-04694-z

Keywords

BMC Veterinary Research

ISSN: 1746-6148

Contact us