Sheep challenged with sheep-derived type II Mycobacterium avium subsp. paratuberculosis: the first experimental model of paratuberculosis in China

Abstract

Background

Paratuberculosis (PTB), caused by Mycobacterium avium subsp. paratuberculosis (MAP), is difficult to diagnose in the early stages and poses substantial challenges in prevention, control, treatment, and eradication. A well-defined animal model can help identify disease markers and serve as a platform for vaccine and drug development. This study used sheep as a ruminant model for experimental MAP infection research.

Methods

Nine 3-month-old lambs with negative MAP antigen and antibody were divided into three groups (control group A and inoculated groups B and C). The inoculated groups were challenged with sheep-derived type II MAP. After exposure, we recorded clinical signs, assessed fecal shedding, tested blood MAP levels, and performed fecal cultures. We also measured MAP-specific antibodies and monitored IFN-γ and IL-10 responses in vivo. At 255 days after inoculation, we performed autopsy, tissue culture, pathomorphological observation, and bacterial organ burden (BOB) testing.

Results

All six sheep in groups B and C were infected, regardless of the challenge dose and exhibited emaciation; two had intermittent soft stools. Intermittent MAP shedding in feces was observed from 60 to 255 days after exposure. Typical MAP colonies formed after 4–6 weeks of fecal and tissue culture, and Ziehl–Neelsen staining showed positive results. In the groups challenged with MAP, some blood samples tested positive for MAP and MAP-specific antibodies were detected in some serum samples. IFN-γ response was significantly higher in groups B and C than that in group A from day 60 post-exposure, whereas the IL-10 response was higher than that in group A from day 120 post-exposure. In the infected groups, the ileal lesions were the most severe and were classified as grade 3 PTB granulomatous inflammation (multibacillary lesions). BOB levels varied across different tissues.

Conclusions

To the best of our knowledge, this is the first experimental MAP challenge study on sheep in China. Polymerase chain reaction detection was more sensitive than MAP culture, whereas enzyme-linked immunosorbent assay was less sensitive for detecting MAP-specific antibodies. IFN-γ and IL-10 responses may serve as targets for monitoring PTB progression. The severity of ileal lesions and acid-fast bacilli grading play crucial roles in the understanding of infection dynamics. Currently, early PTB diagnosis requires a combination of multiple sample types and detection methods.

Introduction

Paratuberculosis (PTB) is a chronic infection primarily caused by Mycobacterium avium subsp. paratuberculosis (MAP) in wild and domestic ruminants. It leads to mesenteric lymphadenitis and granulomatous enteritis, followed by weight loss, diarrhea, and eventual death [1]. Animals are typically infected at a young age by ingestion of fecal-contaminated material, milk, or colostrum, either via in utero transmission or neonatal exposure [2]. The fecal–oral route is the primary mode of MAP transmission [3]. PTB is widespread across multiple countries and is considered a significant disease owing to its economic impact, effects on animal welfare, and public health concerns [4]. Moreover, MAP is a zoonotic pathogen that threatens human health [5] and enters the human food chain through contaminated meat [2], dairy products [6], and untreated water [7].

Core genome analysis has revealed two distinct MAP lineages: types S (sheep strain) and C (cattle strain or type II). Type S includes two sublineages, types I and III, and the Bison type is a distinct clade within type C; however, these are not different strain types of MAP [8,9,10,11,12,13]. Type S strains exhibit slow growth (≥ 16 weeks) and are closely associated with sheep sources, whereas type C strains grow more rapidly (4–16 weeks) and, although commonly found in cattle, have a broader host range [14]. Virulence differs between type S and C strains depending on the host species [15]. Infection of sheep with type S strains results in granulomatous lesions confined to lymphoid tissue, with no difference in lesion intensity over time. Conversely, infection with type C field strains initially causes diffuse lesions, which decrease in severity with prolonged infection duration (150–390 days) and become well-demarcated granulomas with fibrosis [16, 17].

The development of experimental infection models can help understand the dynamics of MAP infection and disease progression [3]. Previously, countries where ovine PTB posed a significant challenge have developed various experimental animal models. These models have been established in the USA (cattle [18,19,20,21,22,23,24], sheep [18, 25], murine [26,27,28,29], rabbit [30], and deer [25]); the UK (cattle [31, 32], sheep [33,34,35], and hamsters and rabbits [36]); South Korea (cattle [37] and murine [38]); Australia (sheep [39,40,41,42,43], cattle [44, 45], and rabbit [46]); Argentina (cattle [47,48,49] and murine [50, 51]); Canada (cattle [52, 53], sheep [54], murine [55, 56], and rabbit [57]); New Zealand (sheep [58, 59, 60]); Spain (sheep [17, 61,62,63,64] and rabbit [65,66,67]); Germany (sheep [68, 69]); Denmark (sheep [70]); Japan (murine [71]); India (cattle [72], sheep [73], and murine [74]); Iran (sheep [75]); the Netherlands (sheep [76]); and Italy (sheep [77]). To the best of our knowledge, no relevant studies have been conducted in China. This study aimed to conduct animal experiments on sheep challenged with a type II MAP strain, providing a foundation for further studies on PTB pathogenesis, early diagnosis, and control strategies.

Materials and methods

Experimental animals

Nine 3-month-old small-tail Han sheep (five males and four females) sourced from a sheep farm in Hohhot, Inner Mongolia, China, were selected for this study. The farm consistently tested negative for PTB based on multiple tests conducted in our laboratory over the past 3 years. No sheep in China were immunized with a PTB vaccine, and the farm did not administer brucellosis vaccination. Before selecting the experimental animals for this study, 20% (60/300) of the farm’s sheep were randomly tested. First, blood samples were collected via the jugular vein, and fecal samples were collected from the rectum. These samples were analyzed for MAP-specific antibodies and antigens (IS900 gene) using enzyme-linked immunosorbent assay (ELISA), DNA extraction, and polymerase chain reaction (PCR) [78, 79], following the manufacturer’s protocols for ID Screen^® Paratuberculosis Indirect Screening Test (ID Vet, Montpellier, France), E.Z.N.A Stool DNA Kit (Omega BioTek Inc., Norcross, GA, USA), and Premix Taq™ (TaKaRa Taq™ Version 2.0 plus dye) (TaKaRa, Beijing, China). Second, we performed serum screening for brucellosis using the plate agglutination test (GB/T 18646-2018, national standard, China), tube agglutination test (GB/T 18646-2018, national standard, China), and indirect ELISA (Laipson, Luoyang, China). Third, genomic DNA was extracted from anticoagulated blood and throat swabs using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver. 5.0 (TaKaRa) and screened for Mycobacterium tuberculosis using a real-time PCR kit (Anheal, Beijing, China), along with fecal DNA analysis. After confirming that all tested sheep were negative for PTB, brucellosis, and tuberculosis, nine 3-month-old lambs were selected and housed in an experimental animal facility for adaptive feeding. They were fed lamb feed and lucerne at regular, quantitative intervals each day and were subsequently dewormed. One week later, they were retested for PTB, brucellosis, and tuberculosis. After confirming the negative results, further animal experiments were initiated. Three groups of sheep were housed under identical conditions in isolation. No experimental animals received antibiotics or immunosuppressive drugs.

MAP preparation and animal grouping for the challenge

MAP was cultivated, identified, and stored at −80°C in our laboratory. A third-passage culture of a type II MAP strain (MAP-NM5), originally isolated from ovine intestines, was used as the inoculum. The seed stock was transferred to 7H9 liquid culture medium (Middlebrook, Becton Dickinson, NJ, USA), supplemented with glycerin (Merck, Darmstadt, Germany), Middlebrook OADC (Middlebrook), and Ferric Mycobactin J (MYCO, ID Vet). The culture was incubated at 37°C with continuous shaking at 160 rpm for 67 days. Optical density at 600 nm (OD₆₀₀) was measured using an ELISA reader (BioTek Instruments, Inc., VT, USA), and culturing was stopped once the bacterial count reached 10⁷ CFU/mL. Subsequently, experimental animals were prepared for inoculation. Batch suspensions were confirmed to contain acid-fast bacilli (AFB) via Ziehl–Neelsen (ZN) staining, and the presence of MAP was verified using PCR, following the aforementioned method.

Nine lambs were randomly assigned to three groups for the MAP challenge: control group A (n = 3; males: 2, female: 1; numbered 1–3), inoculated group B (n = 3; males: 3; numbered 4–6), and inoculated group C (n = 3; females: 3; numbered 7–9). For 4 consecutive days, the inoculated groups were orally inoculated with MAP. Each sheep in group C received approximately 2.57 × 10⁹ CFU of live bacteria, whereas each sheep in group B received approximately 9.2 × 10⁸ CFU. Control group A was administered an equivalent volume of 7H9 liquid culture medium. Post-exposure time was defined as the time elapsed from the date of the first MAP inoculation.

Post-exposure detection

Following the MAP challenge, the clinical symptoms of all experimental animals were monitored daily. Fecal samples were collected from the rectum of each sheep daily during 1–3 days post-exposure. Due to COVID-19 management policies in China, sheep no. 3 from control group A died on day 27 post-exposure, and led to a modification of the sampling schedule. From day 60 post-exposure, fecal samples were collected from the rectum and blood was drawn from the jugular vein at 15-day intervals for serum separation. The methods used for DNA extraction and MAP detection in whole blood and fecal samples as well as for MAP-specific antibody detection in serum were the same as those used during experimental animal selection. Serum interferon-γ (IFN-γ) and interleukin-10 (IL-10) levels were measured using the Sheep IFN-γ ELISA Kit (BlueGene Biotech, Shanghai, China) and Sheep IL-10 ELISA Kit (BlueGene Biotech), according to the manufacturer’s protocols.

The experiment was terminated at 255 days post-exposure, after which the lambs were euthanized and necropsied. Gross lesions examined across various organs and tissue samples, including intestinal and mesenteric lymph nodes, were collected. For histopathological examination, tissue samples were fixed in 10% neutral formalin, embedded in paraffin, sectioned, and stained using hematoxylin–eosin (HE) and ZN staining. The tissue used for electron microscopy was fixed in 2.5% glutaraldehyde, and ultra-thin sections were prepared by Saixin Natural Gene Technology (Beijing, China). For bacterial organ burden (BOB) detection, DNA was extracted using the TaKaRa MiniBEST Universal Genomic DNA Extraction Kit Ver. 5.0 (TaKaRa). Fluorescent quantitative PCR was performed using TB Green® Premix Ex Taq™ II (Tli RNaseH Plus) (TaKaRa). Primers were F1 (AATGACGGTTACGGAGGTGGT) and R1 (GCAGTAATGGTCGGCCTTAC). The BOB results were analyzed using one-way analysis of variance with 95% confidence intervals. Two-tailed p-values <0.05 were considered statistically significant. Data were visualized using Prism 8 (GraphPad, USA).

At each experimental stage, fecal samples were collected, and tissue samples were obtained during necropsy for MAP culture [68]. Following bacterial culture, DNA was extracted using the TaKaRa MiniBEST Bacteria Genomic DNA Extraction Kit Ver. 3.0 (TaKaRa) following the manufacturer’s instructions. PCR was performed, and all PCR-positive products were sequenced by Sangon Biotech (Shanghai, China). The sequencing results were compared with those of the inoculated MAP strain (MAP-NM5). Additionally, colony smears were prepared and subjected to ZN staining.

Results

Clinical signs

Compared with group A, sheep in groups B and C exhibited slower growth rates. At the end of the experiment, the animals were significantly emaciated with dry and dull fur, particularly sheep no. 9. Additionally, sheep nos. 5 and 7 experienced intermittent fecal softening, wherein feces failed to form granules and instead turned into lumps.

Fecal shedding

Overall, 139 fecal samples were collected post-exposure (17 time points × 8 surviving sheep + 3 accidental deaths of sheep). PCR analysis confirmed that all group A fecal samples were negative for MAP, whereas those from groups B and C at 1–3 days post-exposure were positive. From 60 days post-exposure, fecal samples were collected at 14 regular intervals, which revealed intermittent MAP shedding. Fecal shedding detection rates in sheep nos. 4–9 were 42.86% (6/14), 57.14% (8/14), 21.43% (3/14), 64.29% (9/14), 57.14% (8/14), and 64.29% (9/14), respectively. Fecal shedding was first detected at 60 days post-exposure (Table 1).

Table 1 MAP-specific antibodies in serum and MAP antigen detection in feces and blood

Fecal and tissue culture

A total of 14 samples (including 8 MAP-positive samples based on PCR) were collected from sheep nos. 5 and 9 at 60, 75, 90, 105, 120, 135, and 150 days post-exposure, along with 16 tissue samples (ileum and mesenteric lymph nodes) from eight sheep. After 4–16 weeks of cultivation, MAP colonies were observed in four fecal samples: sheep no. 9 at 75 days (culture time: 4 weeks), 105 days (6 weeks), and 150 days (6 weeks) post-exposure and sheep no. 5 at 120 days post-exposure (6 weeks). Additionally, seven tissue samples tested positive: the ileum of sheep no. 4 (4 weeks), the ileum of sheep nos. 5, 7, 8, and 9 (6 weeks), and the mesenteric lymph nodes of sheep nos. 8 and 9 (6 weeks). The colonies appeared nipple-shaped, with irregular edges, a smooth surface, and a creamy or pale yellow color. ZN staining confirmed a short rod-shaped AFB with consistent morphology and size (Fig. 1). PCR amplification of the colonies revealed positive results, and the sequencing results matched the challenge strain (MAP-NM5) gene sequence.

Fig. 1

MAP cultivation and identification (The left panel shows smooth growth of papillary MAP colonies on the surface of culture medium, and the right panel shows Ziehl–Neelsen acid-fast staining of a bacterial smear showing short, rod-shaped acid-fast bacilli (AFB) with uniform morphology and size)

MAP detection in whole blood

Overall, 112 blood samples (14 time points × 8 sheep) were collected post-exposure. All group A samples were PCR-negative for MAP, whereas some samples in groups B and C tested PCR-positive for MAP. MAP was detected in sheep no. 4 (once at 105 days post-exposure), sheep no. 5 (once at 60 days post-exposure), sheep no. 6 (twice at 105 and 180 days post-exposure), sheep no. 7 (four times at 105, 135, 150, and 165 days post-exposure), sheep no. 8 (thrice at 105, 120, and 135 days post-exposure), and sheep no. 9 (twice at 105 and 120 days post-exposure) (Table 1).

Antibody response

Among the 112 serum samples, only sheep no. 7 and 9 tested positive for MAP-specific antibodies: sheep no. 7 tested positive twice (at 90 and 150 days post-exposure) and sheep no. 9 tested positive seven times (75, 180, 195, 210, 225, 240, and 255 days post-exposure) (Table 1).

IFN-γ and IL-10 response

Among the 112 serum samples, group A exhibited extremely low cytokine concentrations, with no significant differences in IFN-γ or IL-10 levels. Conversely, groups B and C showed a significantly higher IFN-γ response than group A from 60 days post-exposure, peaking at 105–135 days, followed by a gradual decline from 150 days and stabilization at a relatively high level between 180 and 255 days, remaining higher than group A. The IL-10 response in groups B and C began increasing compared with that of group A from 120 days post-exposure and showed a continuous upward trend. The IL-10 response of sheep no. 5 was lower than that of the other sheep in groups B and C starting from 150 days post-exposure but was still higher than that of group A (Fig. 2). There were no significant differences in cytokine responses between groups B and C.

Fig. 2

IFN-γ and IL-10 response (The left and right panels show IFN-γ and IL-10 responses, respectively, in sheep serum)

Pathological changes

Gross pathology

Group A exhibited no obvious gross lesions. In groups B and C, sheep exhibited pale visible mucosa, light and sparse blood, small amounts of edematous fluid in the chest and abdominal cavities, muscle thinning, and adipose tissue atrophy with a pale yellow, jelly-like appearance. Additionally, sheep nos. 5 and 7 showed significant edema in the lower jaw. Prominent gross lesions were observed in the intestine and mesenteric lymph nodes.

Lesions in the small intestine, primarily affecting the jejunum and ileum, were characterized by marked intestinal contraction, thickened intestinal walls, and diffuse mucosal folds, giving the intestine a “gyrus-like” appearance. Large intestinal lesions, mainly observed in the cecum and proximal colon, were relatively mild and resembled those in the small intestine. Mild mesenteric lymph node enlargement was noted, with uneven, moist cross-sections that appeared pale or grayish-yellow. Additionally, some mesenteric lymph nodes contained gray–white calcifications of varying sizes on the cut surface (Fig. 3).

Fig. 3

Gross pathology (The left panel shows ileal mucosa exhibiting diffuse folds resembling a gyrus, and the right panel shows mesenteric lymph nodes with an uneven sectional appearance and gray–white calcifications of varying sizes)

Histopathology

Group A sheep exhibited no significant histopathological changes, whereas sheep in groups B and C showed similar lesions, which were mainly concentrated in the intestinal and mesenteric lymph nodes. In the duodenum, cecum, and colon, scattered individual cells or clusters of lymphocytes, macrophages, epithelioid macrophages, and plasma cells were present in the lamina propria, with a few epithelioid macrophages containing sparse AFB in their cytoplasm (Fig. 4). The jejunal villi were blunt and fused, with extensive infiltration of lymphocytes and epithelioid macrophages in the lamina propria, along with the presence of focal granulomas. Most epithelioid macrophages contained a large abundant AFB (Fig. 5). Multifocal granulomatous lesions were visible in the jejunal lamina propria of sheep no. 5. The ileum exhibited intestinal villi atrophy and fusion, with multifocal or diffuse granulomatous lesions surrounded by a large number of lymphocytes in the lamina propria (Fig. 6a). Multinucleated giant cells were observed within the granulomas (Fig. 6b), and a large number of epithelioid macrophages contained a significant amount of AFB (Fig. 6c). In addition, focal fibrotic granulomatous lesions were present in the ileal submucosal layer of sheep no. 5 (Fig. 6d). In the mesenteric lymph nodes, connective tissue hyperplasia was observed in the capsule (Fig. 7a), along with multifocal granulomatous lesions (Fig. 7b) containing numerous macrophages, epithelioid macrophages, and multinucleated giant cells in the cortical region (Fig. 7c). Clusters of AFB were also observed in the cytoplasm of macrophages and epithelioid macrophages in the medulla (Fig. 7d). Liver cell granular degeneration and necrosis were observed in sheep nos. 8 and 9, whereas focal granulomas were observed in the liver parenchyma of sheep nos. 5, 8, and 9 (Fig. 8). Additionally, AFB were present in the macrophages of the retropharyngeal and superficial cervical lymph nodes.

Fig. 4

Histopathology of the duodenum (Left: Hematoxylin–eosin [HE] staining of the duodenal lamina propria showing infiltration of lymphocytes, macrophages, epithelioid macrophages, and plasma cells; Right: Ziehl–Neelsen acid-fast staining of the duodenal lamina propria showing epithelioid macrophages with sparse intracellular acid-fast bacilli [AFB] (red arrow))

Fig. 5

Histopathology of the jejunum (Left: HE staining of the jejunal submucosa showing infiltration of numerous lymphocytes and epithelioid macrophages; Middle: HE staining of the jejunal lamina propria of sheep no. 5 showing granuloma formation with fibrosis; Right: Ziehl–Neelsen acid-fast staining of the jejunal lamina propria showing epithelioid macrophages containing abundant intracellular acid-fast bacilli [AFB] (red arrow))

Fig. 6

Histopathology of the ileum (a: HE staining of the ileal lamina propria showing multifocal granulomatous lesions with visible submucosal layers; b: HE staining of the ileal lamina propria showing diffuse granulomatous lesions with lymphocytes, epithelioid macrophages, and multinucleated giant cells (red arrow); c: Ziehl–Neelsen acid-fast staining of the ileal lamina propria showing numerous epithelioid macrophages with abundant intracellular AFB; d: HE staining of the ileal submucosa of sheep no. 5 showing focal fibrotic granulomatous lesions)

Fig. 7

Histopathology of mesenteric lymph nodes (a: HE staining of mesenteric lymph nodes showing infiltration of lymphocytes, macrophages, and epithelioid macrophages in the subcapsular sinus and paracortex; b: HE staining of the mesenteric lymph node cortex showing multifocal granulomatous lesions; c: HE staining of mesenteric lymph nodes showing granulomas primarily composed of epithelioid macrophages and multinucleated giant cells; d: Ziehl–Neelsen acid-fast staining of mesenteric lymph nodes showing AFB (red arrow) within the cytoplasm of medullary and epithelioid macrophages)

Fig. 8

HE staining of liver parenchyma showing focal granulomas (arrow) composed of lymphocytes, macrophages, and epithelioid macrophages

Ultrastructural pathology

Numerous macrophages were observed in the intestinal and mesenteric lymph nodes, with an increased number of phagolysosomes within the cytoplasm. Mitochondrial swelling and rough endoplasmic reticulum expansion into vesicles were noted. Additionally, both intact and partially degraded MAP were observed in the cytoplasm of macrophages (Fig. 9).

Fig. 9

Transmission electron micrograph. Mesenteric lymph node. Mesenteric lymph node. Engulfed bacteria (black arrow) and damaged or degraded bacteria (black arrowhead) in multinucleated giant cell

BOB

Significant differences in BOB levels were observed between the liver and spleen (p = 0.0149) and between the liver and kidneys (p = 0.0481), whereas no significant difference in BOB levels was observed between the spleen and kidneys (p = 0.8208). The tonsils exhibited a significantly higher BOB levels than the adrenal glands (p = 0.0047) and porta hepatis lymph nodes (p = 0.0059). The mesenteric lymph nodes had a significantly higher BOB than the adrenal glands (p = 0.0003) and porta hepatis lymph nodes (p = 0.0004). There were no significant differences in BOB levels between the tonsils and mesenteric lymph nodes (p = 0.6470) or between the adrenal glands and hepatic hilum lymph nodes (p = 0.9996).

In the intestinal tissues from the duodenum to the rectum, the jejunum, ileum, and cecum exhibited higher BOB levels, with the ileum having the highest BOB (significantly higher than that of the duodenum, cecum, colon, and rectum [p < 0.0001]; significantly higher than that of the jejunum [p = 0.0019]), while the BOB of the rectum was the lowest (significantly lower than that of the jejunum [p = 0.0002]). Furthermore, the jejunum had a significantly higher BOB than the colon (p = 0.0019). Significant differences in BOB levels were also observed between the duodenum and jejunum (p = 0.0318) and between the cecum and rectum (p = 0.0105), whereas no significant differences were observed among the remaining intestinal tissues. All four stomach compartments tested positive for MAP; however, BOB levels were very low, with no significant differences among the compartments.

Discussion

The World Organization for Animal Health has recognized PTB as a major global animal health concern [80] and classified it as a “neglected disease” [81]. No country has been declared free of MAP [82]. However, under-reporting and underestimation of prevalence remain widespread, and many countries lack formal control plans [4]. Effective PTB control requires critical progress in diagnosis and vaccine development and a deeper understanding of host–pathogen interactions [83]. PTB experimental infection models are crucial for studying epidemiology, economic impact, infection dynamics, and control strategies [3]. In Chinese terminology, the relationship between the pathogen and animal model can be likened to the spear and shield, allowing exploration of both pathogen virulence (spear sharpness) and host resistance (shield strength). Small ruminants are natural hosts for MAP, with sheep serving as an ideal animal model for PTB, which has several advantages, including genetic consistency, low cost, and ease of experimental operation [84]. Historically, sheep has been a convenient ruminant model in MAP infection research [3]. In this study, the combination of MAP colonization, intestinal and mesenteric lymph node granuloma, multibacillary lesions, and fecal shedding satisfied the criteria for developing a successful sheep infection MAP model [3].

Clinical signs

In the present study, MAP-infected sheep exhibited clinical changes, including malnutrition, indicating that MAP negatively affects sheep health. However, only sheep nos. 5 and 7 showed intermittent fecal softening, without the typical symptoms of PTB-associated diarrhea [3]. In small ruminants, the symptoms of PTB are subtler, with a long incubation period in sheep. Clinical symptoms typically appear between 2 and 4 years of age and are primarily manifesting as progressive emaciation [85]. The post-exposure results indicate different stages of MAP infection, including latent infection, active infection, and clinical affection [3]. Based on the results of various tests conducted on sheep after the MAP challenge at 255 days in this study, the infection was classified as active. Although the affected sheep did not exhibit classic PTB symptoms, significant pathological damage was observed in some individuals, indicating potential progression toward clinical disease and implications for infection dynamics. Additionally, PTB outcomes following exposure are influenced by host-related factors (age at exposure and breed) and pathogen-related factors (MAP dose, strain type, and inoculum used in experimental infections) [3, 86].

Fecal shedding

In this study, fecal tests conducted 1–3 days after exposure detected MAP, indicating pass-through rather than active shedding. From 60 days post-exposure, intermittent MAP-positive fecal samples indicated active shedding and true infection. These findings align with those of previous studies in that pass-through occurs within 10 days of oral MAP ingestion [87], and 14 days post-inoculation fecal shedding indicates the proliferation of host MAPs [88]. Histopathological examination of the ileum revealed multibacillary lesions despite the absence of persistent fecal shedding. Consistent with previous reports, transient shedding began 2 months after inoculation [89]. A long-term study (3–4.5 years) documented intermittent shedding in 10 sheep during the first year [90]. Additionally, in a previous study, fecal samples collected 42 days after exposure in a caprine model were positive for MAP [68]. However, as the earliest sampling in this study occurred at 60 days post-exposure, determining the earliest fecal shedding time was not possible. Fecal shedding indicates that infected animals act as risk factors, repeatedly exposing susceptible animals to MAP, thereby influencing infection dynamics. The progression of this infection may lead to continuous daily shedding, thereby becoming a significant risk factor in infection dynamics. Alternatively, shedding may cease permanently within 16 months post-exposure [3]. Because the present study had a 255-day challenge period, it was difficult to predict the possibility of permanent shedding and its cessation.

Although MAP culture identification is considered the “gold standard” for PTB diagnosis [91], PCR detection in this study demonstrated higher sensitivity than MAP culture results. Previous studies have also reported transient MAP shedding in the feces of most sheep within the first few months post-inoculation [92], and quantitative PCR—a more sensitive method—can effectively distinguish between low and high shedders [90]. The low sensitivity of fecal culture may be attributed to intermittent shedding in the early stages of infection, wherein MAP levels decrease beyond the detection limit. Additionally, antibiotic treatment of fecal samples before culture can inhibit MAP growth [93]. Tissue PCR is more sensitive than tissue culture, particularly for latent infection [94, 95].

MAP detection in whole blood

In this study, intermittent or short-term sustained MAP positivity in blood was observed via PCR in sheep no. 5 (60 days post-exposure), sheep no. 4 (105 days post-exposure), sheep no. 6 (105 and 180 days post-exposure), sheep no. 9 (105 and 120 days post-exposure), sheep no. 8 (105, 120, and 135 days post-exposure), and sheep no. 7 (105, 135, 150, and 165 days post-exposure), primarily during the early post-exposure stages. MAP has been detected in the blood of infected cattle and sheep via PCR and in the blood of patients with Crohn’s disease via culture and PCR [88]. Additionally, bacteremia has been reported in goats, deer, and other species [88]. Findings from this study, combined with histopathological lesions in the intestine and liver, indicate that orally ingested MAP may enter the intestine, travel through the portal vein to the liver, and subsequently enter the bloodstream via the posterior vena cava, leading to low-level transient bacteremia.

Antibody response

In this study, only sheep no. 7 (90 and 150 days post-exposure) and sheep no. 9 (75, 180, 195, 210, 225, 240, and 255 days post-exposure) exhibited intermittent or transiently continuous positive antibody responses. Compared with MAP culture, ELISA is a cost-effective alternative for PTB detection [96], with a specificity of 48%–92% and a sensitivity of 50%–70% for PTB detection [97]. Previous studies have also reported significant variability in antibody responses. For instance, one study found that over one-third of sheep tested positive after 8 weeks post-inoculation, with 41%–55% positivity during the study period [60]. The first pure-culture MAP sheep infection model detected no antibody response after 4 months post-exposure, and only 10% of sheep tested positive by 8 months post-exposure [40]. Variability in ELISA results for anti-MAP antibody detection can be attributed to the delayed interval between the humoral immune response in infected sheep, differences in antigen composition across commercial ELISA kits used in different countries, and cross reactivity with other mycobacteria, which may compromise the specificity of serological testing [60].

IFN-γ and IL-10 response

A longitudinal analysis of immune responses throughout PTB progression is crucial for understanding disease pathogenesis, diagnostic potential, and biomarker identification [45]. In this study, the exposure groups had higher IFN-γ levels than the control group from 60 days post-exposure, which peaked between 105 and 135 days post-exposure, began to decline at 150 days, and remained relatively stable from 180 to 255 days post-exposure. At 120 days post-exposure, the IL-10 response was higher than that in the control group and showed a continuous upward trend. This finding is consistent with that of de Silva et al. [98], who reported that IL-10 levels increased at 4 months post-inoculation in sheep. Coussens et al. [99] reported elevated IL-10 gene expression in peripheral blood mononuclear cells from subclinical-stage cows stimulated with MAP in vitro. IL-10 expression significantly differs between sheep with paucibacillary and those with multibacillary disease [100]. The switching between Th1 and Th2 responses is a complex process that may be triggered by MAP exposure dose, macrophage bursting size, T-cell exhaustion, and other host-level metabolic triggers [3]. Additionally, infection with type C MAP strains has been reported to elicit a stronger IFN-γ response [3].

Pathological changes

In this study, gross lesions included intestinal mucosa thickening, mesenteric lymph node enlargement, and lymphangiectasia, consistent with the findings reported by Verin et al. [101]. These lesions hinder the intestinal absorption of water and nutrients, thereby leading to diarrhea, emaciation, and cachexia in affected animals [102]. This study concluded 255 days post-exposure, and the sheep did not exhibit diarrhea and cachexia; however, histopathological and ultrastructural lesions reflected severe damage to tissue function.

The primary focus in the PTB examination was granulomatous inflammation and AFB presence. In this study, sheep in groups B and C exhibited similar lesions, with ileal lesions being the most severe. Multifocal granulomatous lesions and multinucleated giant cells were observed, and most epithelioid macrophages contained a large amount of AFB. Based on the earliest PTB histopathological classification system [103] and the granulomatous inflammation grading system for ileal and mesenteric lymph node lesions [104], lesion severity is categorized as follows: grade 1, few or clustered epithelioid macrophages and rare AFB; grade 2, focal granuloma with only a few macrophages containing small amounts of AFB; grade 3, multifocal granulomatous inflammation, wherein most macrophages contain abundant AFB; and grade 4; diffuse granulomatous inflammation, wherein most macrophages are expanded due to AFB accumulation. According to the aforementioned lesion grading criteria, it was classified as grade 3. A previous study showed that an MAP challenge dose of 10³–10⁶ CFU induces focal lesions, whereas a higher dose of 10⁸–10⁹ CFU results in extensive and severe lesions [3]. In this study, the inoculation dose corresponded with the severity of observed lesions. Sheep typically develop lesions within 6–12 months after positive culture detection [104]. In this study, MAP culture yielded positive results at 75 days post-exposure, which was in agreement with the lesions observed at the 255-day post-exposure necropsy. Additionally, the presence of intestinal histopathological lesions appears to be a strong indicator of MAP shedding and vice versa [3].

The results of this study demonstrated that the ileal BOB was the highest, and acid-fast staining revealed that the ileal lesions were multibacillary lesions. Previous studies have reported that MAP infection initially establishes in the lymphoid tissue of the small intestine, which may cause segmental lesions at multiple locations and spread to the lamina propria and local lymph nodes [73]. The ileum may be the first site of MAP invasion and colonization [20]. MAP antigen exposure triggers an inflammatory response in the intestinal and mesenteric lymph nodes, resulting in granuloma formation. Granulomatous inflammation with MAP-containing macrophage infiltration occurs in the ileum [105]. In naturally infected sheep, lesions are primarily found in the jejunum, ileum, and mesenteric lymph nodes [94, 104]. Consistent with the findings of this study, a previous study reported that MAP is more abundant in the intestinal mucosa than in the mesenteric lymph nodes [104]. Therefore, active infection, particularly in the early stages, can be determined by histopathological examination of the ileum or jejunum rather than mesenteric lymph nodes. Moreover, previous studies have clearly stated that histological lesions and their grading are good indicators of active infection and affection [3].

In this study, multinucleated giant cells were observed in the ileal and mesenteric lymph nodes of sheep challenged with type II MAP. The presence of Langhans-type giant cells is reported to be a typical feature of C strain–induced lymph node granuloma [17]. Multinucleated giant cells are mainly observed in severe cases, and the more numerous they are, the higher is their effect on inflammation [106]. These cells can clear cellular debris and free MAP antigens at the site of lesions [107]. Additionally, sheep no. 5 exhibited focal fibrotic granulomatous lesions in the ileal submucosal layer, indicative of a “regressive”-type granuloma change. This indicates a potential shift toward lesion regression, disease recovery, and MAP clearance [3].

Notably, the tonsils exhibited a higher BOB than the adrenal glands and porta hepatis lymph nodes. In addition to the small intestine, the tonsils are reported to be a common site of MAP invasion [23]. Moreover, in the present study, liver focal granulomas and intestinal and mesenteric lymph node–associated tissues had a certain degree of BOB, and posterior pharyngeal and superficial cervical lymph nodes had AFB. These findings are consistent with those of a previous study reporting persistence of MAP in extraintestinal tissues, as observed in goats 12 months post-inoculation [69]. The outcomes of MAP challenge depend on various biological factors, including the MAP strain, inoculation dose, route of exposure, sheep breed, age at infection, culture conditions (subcultured organisms vs. tissue homogenates), and host susceptibility. In conclusion, early diagnosis of PTB should be based on actual scenarios by combining multiple sample types and testing methods.